Navigation: Suites / Filters / Types / Fields / Sort / Format / Search / Results

Bugs search

Useful queries for testing (bookworm)

Suites[1]

Filters

off / include / exclude
  • tagged confirmed
  • tagged patch
  • tagged pending
  • tagged security
  • tagged wontfix
  • tagged moreinfo
  • tagged upstream
  • tagged unreproducible
  • tagged help
  • tagged d-i
  • forwarded upstream
  • claimed bugs
  • fixed in deferred/delayed
  • packages not in main
  • packages not in stretch
  • packages not in buster
  • packages not in bullseye
  • packages not in bookworm
  • packages in base system
  • packages in standard installation
  • orphaned packages
  • merged bugs
  • marked as done
  • outdated binaries in stretch
  • outdated binaries in buster
  • outdated binaries in bullseye
  • outdated binaries in bookworm
  • outdated binaries in sid
  • different versions in bookworm and sid
  • newer in Ubuntu than in sid
  • RT tag for stretch: ignore
  • RT tag for stretch: will-remove
  • RT tag for stretch: can-defer
  • RT tag for stretch: is-blocker
  • RT tag for stretch: no-auto-remove
  • RT tag for stretch: pu
  • RT tag for buster: ignore
  • RT tag for buster: will-remove
  • RT tag for buster: can-defer
  • RT tag for buster: is-blocker
  • RT tag for buster: no-auto-remove
  • RT tag for buster: pu
  • RT tag for bullseye: ignore
  • RT tag for bullseye: will-remove
  • RT tag for bullseye: can-defer
  • RT tag for bullseye: is-blocker
  • RT tag for bullseye: no-auto-remove
  • RT tag for bullseye: pu
  • RT tag for bookworm: ignore
  • RT tag for bookworm: will-remove
  • RT tag for bookworm: can-defer
  • RT tag for bookworm: is-blocker
  • RT tag for bookworm: no-auto-remove
  • RT tag for bookworm: pu
  • RT unblock hint
  • RT blocked
  • RT too young
  • RT ready to migrate
  • key packages
  • pseudo packages
  • packages marked for autoremoval
  • closed in packages in new
  • newer than days
  • modified in the last days
  • blocking bug
  • usertag for user

Bugs or packages selection


  ignore:
  ignore:
  ignore:
 
 

Additional fields

Sort

Format

1836 bugs found

bug# package title modified
#321449 gcc-snapshot gcc-snapshot should stay in unstable 2017-01-25
#359095 dh-kpatches dh-kpatches: bugs in apply perl script 2007-07-14
#388141 www.debian.org www.debian.org SPI copyright claim not legally valid until all contributors are contacted for relicensing 2021-09-22
#446343 cutter cutter: does not work at all 2017-12-06
#497471 cdimage.debian.org sarge images have syslinux binaries without source 2019-04-04
#507706 cdimage.debian.org Missing sources for d-i components/kernel of etch-n-half images 2019-04-04
#516394 djbdns [security]: Rapid DNS Poisoning in dnscache 2020-08-03
#534756 fusesmb fusesmb.cache fails on 64-bit 2021-02-01
#548024 www.debian.org packages.debian.org: mirror doesn't close old databases 2021-09-22
#558422 grub-pc grub-pc: upgrade hangs 2021-08-14
#607969 sqlite sqlite: removal of sqlite 2 is really overdue 2021-08-16
#611634 src:freedict-swa-eng freedict-swa-eng: FTBFS: dictd2dic: command not found 2018-06-22
#614497 doc-debian doc-debian: The OPL-licensed documents taken from Debian website are non-free 2021-09-22
#637501 dtc-common dtc-common: modifies config files of other packages 2011-08-13
#637622 dtc-common dtc-common: places configuration files in /var/lib 2012-06-14
#640605 dtc-postfix-courier dtc-postfix-courier: installation fails: /var/run/courier/authdaemon/pid.lock: No such file or directory 2011-09-08
#650080 hurd hurd-specific perl test failures 2011-11-26
#651291 gcc-snapshot gcc-snapshot contains evil gfdl licensed man pages 2017-01-22
#665334 fontforge non-DFSG postscript embedded in fontforge (currently August 2014 2020-12-18
#678493 masqmail masqmail: prompting due to modified conffiles which were not modified by the user 2014-08-28
#694308 general A lot of type 1 fonts include Adobe all right reserved code 2020-01-24
#694320 gsfonts [gsfonts] Fonts include copyrighted adobe fragment all right reserved 2021-02-14
#694323 lmodern [gsfonts] Fonts include copyrighted adobe fragment all right reserved 2020-02-20
#694324 tex-gyre Fonts include copyrighted adobe fragment all right reserved 2020-02-20
#702011 src:gtkmathview gtkmathview: uses pangox which is going away 2021-08-16
#717636 texlive-lang-other [latex-sanskrit] Package contain type1 startlock fragment from black book 2020-02-20
#733094 uvcdynctrl fills disk writing to /var/log/uvcdynctrl-udev.log 2021-01-21
#737395 funny-manpages funny-manpages: Copyright problem 2021-02-02
#740893 libjs-jquery-hotkeys libjs-jquery-hotkeys: jquery.hotkeys changes break python-coverage html reports. 2020-12-17
#743062 src:mutextrace mutextrace: sometimes FTBFS: testsuite races 2021-08-16
#754026 src:sdic sdic: please switch to emacs24 2021-08-16
#756997 critterding Segfaults on start 2015-07-31
#762835 openafs-fileserver error exit on dafileserver (segfault) 2016-04-19
#763824 libtar0 writes archives with checksums itself deems wrong 2021-02-14
#769155 kde-workspace-bin kde-workspace-bin: laptop does not go to sleep when critical battery level is reached 2017-02-24
#769218 src:gcc-4.9 gcc-4.9: FTBFS in jessie: Error! CRCs do not match! Got 264aca47, expected 95962ba4 2021-08-16
#771187 primesense-nite-nonfree primesense-nite-nonfree: Package broken because openni.org is gone 2017-02-11
#774149 usbmount usbmount: Can't mount ntfs drive (Transport endpoint is not connected) 2020-10-02
#776920 blcr-dkms blcr-dkms: fails to build kernel module for 3.16.0-4-amd64 2015-02-03
#777595 src:update-notifier update-notifier: Wrong license in debian/copyright (compared to COPYING) 2015-05-29
#778111 src:scheme2c scheme2c: ftbfs with GCC-5 2021-08-16
#778749 dtc-cyrus dtc-cyrus: depends on obsolete cyrus-*-2.2 2015-02-19
#780480 navi2ch navi2ch: Please change default server 2021-02-05
#781538 installation-reports debian-boot: Total trash on reboot of RAID1 partitions 2018-08-03
#783420 php-mime-type php-mime-type: Needs an update for PHP 7.0 2021-08-16
#785394 pybliographer pybliographer: Please remove redundant call to dh_scrollkeeper (in experimental) 2018-07-08
#788721 firefox-esr firefox-esr: Some sources are missing 2019-04-27
#789292 src:dmtcp dmtcp: FTBFS with glibc-2.21 and gcc-5 2020-12-09
#793668 angband-audio angband-audio: maintainer scripts mishandle angband-data's /usr/share/angband/xtra/sound/sound.cfg 2018-09-23
#794466 src:virtualbox virtualbox: might not be suitable for stable releases due to lack of cooperation from upstream on security support for older releases 2021-08-16
#796495 yubiserver yubiserver: multiple vulnerabilities, affecting old/stable? 2016-01-03
#796536 src:criu criu: package not yet ready for stable release / fast moving (blocking bug) 2021-02-17
#796636 oss4-base oss4-base: Has init script in runlevel S but no matching service file 2021-08-16
#797239 src:fedmsg-meta-fedora-infrastructure fedmsg-meta-fedora-infrastructure: FTBFS: most tests fail: fedmsg: WARNING: No fedmsg.meta plugins found. fedmsg.meta.msg2* crippled 2021-08-16
#798099 xmms2-scrobbler Do not work after last.fm made upgrades 2016-09-10
#799097 mrtg-rrd mrtg-rrd: Regression after the fix for bug #787608. 2017-07-10
#799805 src:kytea kytea: Problem with upcoming new version of liblinear 2021-08-16
#801587 apt-offline "apt-offline (old) stable fixes for Wheezy" 2021-09-22
#802416 src:zemberek-ooo zemberek-ooo: FTBFS: /usr/lib/libreoffice/ure-link/share/java does not exist 2021-08-16
#803721 kdm kdm stopped working and is now stuck on a lightdm saved session 2015-11-03
#805988 src:aboot aboot: FTBFS on amd64 when built with dpkg-buildpackage -A 2021-08-16
#806377 debirf fails to build jessie image 2018-02-20
#806624 src:ikvm ikvm: FTBFS when built with dpkg-buildpackage -A (mkdir: File exists) 2018-10-03
#806930 pianobar pianobar needs update for new server SSL certificate 2015-12-05
#806946 bindgraph bindgraph doesn't show any graphic 2018-05-18
#807168 src:debian-installer-netboot-images debian-installer-netboot-images: required resources not declared as build-dependencies (fetches via network) 2020-02-20
#808617 src:datanommer.commands datanommer.commands: FTBFS: KeyError: 'fas' 2018-06-22
#809599 src:dh-kpatches dh-kpatches: Please change dependency from obsolete openjade1.3 to openjade 2021-08-16
#813175 lucene-net lucene-net: FTBFS CSC: error CS0518: The predefined type `System.Object' is not defined or imported 2018-06-22
#813492 kde-workspace-bin kde-workspace-bin: kdeinit4 increase memory-consumption by every extern ssh-login and never release it 2016-02-04
#816393 debget debget: does not download tar.xz orig files 2021-10-15
#817635 src:pybliographer pybliographer: Removal of debhelper compat 4 2018-07-08
#817954 src:firefox Keep Firefox out of Debian releases 2020-06-14
#820091 php-horde-mongo Switch from php-mongo to php-mongodb is needed 2016-04-05
#821577 php-google-api-php-client php-google-api-php-client: PHP 7.0 Transition 2021-08-16
#822379 src:hidrd hidrd FTBFS on several platforms 2019-02-13
#823236 sso.debian.org login error 2021-09-22
#823683 php-services-json PHP 7.0 Transition 2021-08-16
#825265 dtc-common dtc-common: uninstallable, dependencies php-crypt-cbc, php-net-ipv4, php-xml-serializer are gone 2021-03-05
#826213 w3c-dtd-xhtml w3c-dtd-xhtml: inconsistencies in copyright file 2016-06-03
#828159 firefox-esr firefox-esr: session tabs lost after upgrade from iceweasel to firefox-esr 2017-05-25
#828550 src:socat socat: FTBFS with openssl 1.1.0 2020-09-27
#830596 sa-learn-cyrus sa-learn-cyrus: depends on cyrus-imapd-2.4 which is gone 2021-08-16
#830916 redmine-plugin-recaptcha ActionView::Template::Error (undefined method `recaptcha_tags` ...) 2016-07-12
#831835 iceweasel iceweasel: Padlock icon indicates a secure SSL connection established w MitM-ed 2020-10-20
#831952 src:thp thp: FTBFS with dpkg-buildpackage -A: dpkg-genchanges: error: binary build with no binary artifacts found; cannot distribute 2021-08-16
#832087 mps-youtube mps-youtube: Missing dependency python-pkg-resources 2016-07-30
#832116 src:edgar edgar: Source missing for some GPL licensed assets 2016-10-29
#833828 python3-django-markupfield Migrations of stable's python3-django-markupfield (1.2.1) do not work with stable's django version (1.7.x). 2016-10-15
#835107 src:libpthread-workqueue libpthread-workqueue: FTBFS: Testsuite hangs 2019-04-13
#835166 libmyodbc libmyodbc: SIGFPE, Arithmetic exception in sqlchar_as_sqlwchar 2021-08-16
#836450 src:vowpal-wabbit FTBFS: RunTests: test 5: FAILED: ref(train-sets/ref/0002a.stderr) != stderr(0002a.stderr) 2018-06-22
#836934 src:frobtads frobtads: FTBFS with C++14 on i386: error: exception cleanup for this placement new selects non-placement operator delete 2021-08-16
#837091 firefox-esr firefox-esr: EME DRM extention present and enabled 2018-09-18
#838137 src:critterding critterding: FTBFS in experimental: be_command_system.cpp:13:94: error: '_1' was not declared in this scope 2021-07-31
#838244 hurd hurd: license incompatibility between ext2fs (GPLv2-only) and libparted (GPLv3-or-later) 2016-09-18
#839432 src:libmonitoring-availability-perl libmonitoring-availability-perl: FTBFS: Tests failures 2021-08-16
#840748 edb edb: install script failed for emacs25 because of :indent keyword 2019-07-08
#841561 src:myodbc myodbc: FTBFS: stringutil.c:71:29: error: too few arguments to function 'my_malloc' 2021-08-16
#844145 src:elektra elektra: FTBFS: kdberrors.h:489:0: error: invalid storage class for function 'elektraSetErrorf8' 2019-07-08
#845848 gnokii gnokii: switch to build depend on the metapackage default-libmysqlclient-dev 2021-08-16
#846200 src:elektra FTBFS: test_kdb failing: libelektra-resolver.so: cannot open shared object file: No such file or directory 2018-06-22
#846449 src:srg srg: add libfl-dev to Build-Depends 2021-08-16
#848432 dtc-common dtc-common: Should Depends/Recommends the metapackage default-mysql-* 2017-01-11
#848433 dtc-cyrus dtc-cyrus: Should Depends/Recommends the metapackage default-mysql-* 2017-01-11
#848434 dtc-postfix-courier dtc-postfix-courier: Should Depends/Recommends the metapackage default-mysql-* 2017-01-11
#848435 dtc-postfix-dovecot dtc-postfix-dovecot: Should Depends/Recommends the metapackage default-mysql-* 2017-01-11
#849630 libmyodbc libmyodbc: Programs using it fails with floating point exeption, then connects to mariadb 2019-04-02
#849665 src:golang-github-coreos-go-tspi golang-github-coreos-go-tspi: FTBFS on 32-bit: type [1073741824]C.struct_tdTSS_PCR_EVENT larger than address space 2021-07-05
#851592 src:elektra elektra: creates huge temporary file (100 GB) during build 2018-06-22
#851666 php-sabre-event php-sabre-event: PHP 7.0 transition 2017-01-17
#851671 icinga-web icinga-web: Mysql error: Specified key was too long; max key length is 767 bytes 2018-02-12
#852135 debdelta debdelta: installation leaves gpg-agent process running 2017-02-07
#852457 src:myodbc myodbc: switch to build depend on the metapackage default-libmysqlclient-dev 2021-08-16
#852653 installation-reports Grub install failed on encrypted LVM disk 2021-02-24
#852674 cfengine3 cfengine3: should depend on exact version of libpromises3 2021-08-21
#853008 src:mysql-8.0 mysql-server-5.7: purge could delete mariadb-server files with inadequate warning 2021-03-03
#853298 src:accelio accelio: ftbfs with GCC-7 2021-08-16
#853443 src:hidrd hidrd: ftbfs with GCC-7 2021-08-16
#853456 src:ion ion: ftbfs with GCC-7 2021-08-16
#853750 hdfview hdfview: HDF5 files appear empty 2019-10-27
#855453 mps-youtube mps-youtube can't search anything 2017-05-25
#855461 esniper esniper: fails to login to eBay 2021-04-25
#855521 lxpanel lxpanel: freezes all the desktop environment if started or lauch no matter desktop are used 2017-03-28
#855541 purple-matrix purple-matrix: Not ready for release yet 2020-09-28
#855837 golang-petname golang-petname: should this be in bullseye 2021-02-08
#857299 libsnmpkit2c2a libsnmpkit2c2a:ppc64el is an empty package 2018-10-03
#858377 libblkmaker libblkmaker: doesn't support current bitcoin block version 2017-05-06
#859926 speech-dispatcher breaks with pulse-audio as output when spawned by speechd-up from init system 2021-08-14
#860044 src:icinga-web icinga-web: FTBFS: checking if php has xsl module... configure: error: not found 2018-06-22
#860336 php-http-request parse error in Request.php 2020-06-28
#860608 src:golang golang: FTBFS: Go version is "go1.6.1", ignoring -next /<<PKGBUILDDIR>>/api/next.txt 2021-08-16
#861029 aptdaemon AttributeError: When using gi.repository you must not import static modules like "gobject" 2017-04-23
#862378 check-all-the-things check-all-the-things: not suitable for Debian stable at this time 2021-09-22
#863596 mytop mytop can't be installed 2019-02-05
#863650 libpam-pgsql libpam-pgsql: SIGSEGV with invalid password stored in the database 2020-05-05
#864423 dmraid Software RAID is not activated at boot time 2021-04-10
#864452 src:vtkdata vtkdata: do not ship in stretch 2021-08-16
#864472 zeroc-ice-manual zeroc-ice-manual: outdated version 2021-08-16
#865490 installation-reports installation-reports: debian stretch freezes after install on HP pavilion x2 (cpu atom X5-Z8300) 2017-06-23
#866395 libapache2-mod-ruid2 libapache2-mod-ruid2: Server crashes (Signal 6 aborted) with mod_ruid2 after jessie->stretch update 2021-08-16
#867261 src:tldp tldp FTBFS with Python 3.6 as supported Python version 2019-07-08
#867376 src:uncrustify uncrustify: fills up buildd disk space 2017-10-22
#868882 libmyodbc libmyodbc: The package is not installable in Sid due to missing libmysqlclient18 dependency 2021-08-16
#868928 src:dmtcp dmtcp: FTBFS: pidwrappers.h:191:20: error: '__WAIT_STATUS' was not declared in this scope 2021-08-16
#869190 src:golang-github-minio-cli golang-github-minio-cli FTBFS: FAIL: TestFlagsFromEnv 2018-06-22
#872487 src:vdr-plugin-infosatepg vdr-plugin-infosatepg FTBFS with vdr 2.3.8 2021-08-16
#872495 src:vdr-plugin-remoteosd vdr-plugin-remoteosd FTBFS with vdr 2.3.8 2021-08-16
#872741 src:ants ants: frequent test failures on amd64 2021-08-16
#873148 node-shell-quote Fails to properly escape the ;, {, }, <, and > characters 2017-08-24
#873160 python-pymad python-pymad: pymad in stretch decodes to noise 2021-02-10
#874070 src:rtpproxy rtpproxy: CVE-2017-14114 2017-12-21
#875184 src:sofa-framework [sofa-framework] Future Qt4 removal from Buster 2021-08-16
#875358 src:powermock Fails with Java 9, >2.0.0 required to work 2021-08-16
#875373 src:libi8x libi8x: FTBFS on s390x and sh4: TestPy8xNatfuncImpl trouble 2019-01-04
#875386 src:phonetisaurus phonetisaurus: FTBFS: error: 'EncodeTable' does not name a type 2020-09-27
#875448 src:emacs24 emacs24: CVE-2017-14482: enriched text remote code execution 2019-01-24
#875449 src:emacs23 emacs23: CVE-2017-14482: enriched text remote code execution 2019-01-24
#875594 src:kryo-serializers FTBFS with Java 9: test failures around reflection on core classes 2021-08-16
#875995 src:sump-logicanalyzer sump-logicanalyzer: missing B-D: ant 2017-09-17
#876230 src:ssh-askpass-fullscreen ssh-askpass-fullscreen: FTBFS: undefined reference to symbol 'XUngrabServer' 2020-09-27
#876231 ruby-nmatrix ruby-nmatrix: FTBFS with GCC 7: error: call of overloaded 'abs(nm::Rational<short int>&)' is ambiguous 2020-08-27
#876238 src:gcc-cross-support gcc-cross-support: FTBFS, wants to regenerate debian/control with more and renamed packages 2020-09-27
#876566 printfilters-ppd printfilters-ppd: Depends of no longer available package (mpage) 2021-08-16
#876621 src:redmine-recaptcha redmine-recaptcha: missing build dependency on rename 2021-08-16
#876892 src:dh-kpatches dh-kpatches FTBFS with gtk-doc-tools 1.26: docbook-2-html: unknown style `gtk' 2021-08-16
#876908 src:blcr Is blcr completely useless? 2021-08-16
#877015 src:fizmo fizmo FTBFS with debhelper 10.9 2021-08-16
#877034 src:yap yap FTBFS on i386: YAP OOOPS: tried to access illegal address 2021-08-16
#877035 mps-youtube mps-youtube: crashes with TypeError after search 2018-05-28
#877106 pinta pinta: Pinta 1.6-2 crashes on image scaling and other image manipulation. 2020-06-26
#877122 libengine-pkcs11-openssl1.1 libengine-pkcs11-openssl1.1: Engine is installed into wrong directory on i386 2019-03-04
#877238 src:blcr blcr: FTBFS: /bin/sh: 1: cd: can't cd to debian/blcr-source/usr/src/modules/blcr 2021-08-16
#877317 golang-golang-x-debug golang-golang-x-debug: FTBFS on i386 2017-09-30
#877319 src:golang-github-golang-geo golang-github-golang-geo: FTBFS on i386 2020-09-27
#878983 src:cduce cduce FTBFS with OCaml 4.05.0 2021-08-16
#879469 resteasy Should not enter testing 2018-12-08
#880324 src:ruby-license-finder ruby-license-finder: FTBFS: ERROR: Test "ruby2.3" failed: Failure/Error: expect { action_items }.to raise_error(SystemExit) 2021-08-16
#880786 src:doc-linux-fr doc-linux-fr build depends on removed transitional package lynx-cur 2021-08-16
#880879 src:haskell-dpkg haskell-dpkg FTBFS: hlibrary.setup: parsing output of pkg-config --modversion failed 2019-07-08
#881580 googleearth-package googleearth-package: Generated package is uninstallable, and application unrunnable 2018-07-07
#881676 src:elektra elektra: FTBFS with current cmake: A duplicate ELSE command was found inside an IF block. 2018-11-27
#881911 monobristol monobristol: does not start 2017-11-16
#882305 libfinance-yahooquote-perl libfinance-yahooquote-perl: yahooquote (and smtm) stopped working. 2018-02-24
#882393 installation-reports Subject: installation-reports: Buster installer hangs in vgchange 2017-11-22
#882901 src:php-numbers-words php-numbers-words FTBFS with phpunit 6.4.4-2 2021-08-16
#882910 src:php-http-request2 php-http-request2 FTBFS with phpunit 6.4.4-2 2021-08-16
#882915 src:php-sabre-event php-sabre-event FTBFS with phpunit 6.4.4-2 2021-08-16
#882923 src:php-sabre-uri php-sabre-uri FTBFS with phpunit 6.4.4-2 2021-08-16
#882935 src:php-sabre-http php-sabre-http FTBFS with phpunit 6.4.4-2 2021-08-16
#882949 src:php-sabre-xml php-sabre-xml FTBFS with phpunit 6.4.4-2 2021-08-16
#883107 src:octicons octicons: Ships binaries without building them 2017-12-06
#884018 src:yamcha yamcha: FTBFS with debhelper >= 10.9.2: dh_systemd_enable is no longer used in compat >= 11, please use dh_installsystemd instead 2020-09-27
#884210 mediagoblin mediagoblin: fails to clean after build: rm: cannot remove './docs/build': Is a directory 2017-12-12
#884234 bareos bareos: Stable update fails to configure (no database version defined, FAILED to set Catalog MyCatalog dbdriver = postgresql) 2017-12-12
#884710 src:ants ants: FTBFS: URL using bad/illegal format or missing URL 2020-09-27
#885140 src:wicd wicd: Depends on unmaintained pygtk 2020-11-14
#885195 src:geda-gaf geda-gaf: please upload latest version which uses guile-2.2 2021-08-16
#885563 src:vte vte: Do not release with bookworm 2021-10-10
#886617 src:python-pmw python-pmw: Please package version 2.0.0 and include Python 3 support 2021-08-16
#886874 src:pacapt pacapt FTBFS: a2x: ERROR: "xmllint" --nonet --noout --valid "/build/1st/pacapt-2.3.14/debian/pacapt.1.xml" returned non-zero exit status 4 2018-06-22
#887139 installation-reports d-i daily 2018-01-14 amd64 damages UEFI setup on Fujitsu Lifebook AH532 2021-05-06
#887649 cdebconf-gtk-terminal cdebconf-gtk-terminal: Please don't depend on unmaintained vte 2021-08-16
#887880 src:boinc-app-eah-brp boinc-app-eah-brp: non-standard gcc/g++ used for build (gcc-5) 2019-11-26
#888060 kcm-ufw kcm-ufw: FTBFS: error: template specialization with C linkage 2018-01-23
#888331 src:vdr-plugin-softhddevice vdr-plugin-softhddevice: FTBFS with FFmpeg 4.0 2021-08-16
#888933 src:gli gli FTBFS with libglm-dev 0.9.9~a2-1 2021-08-16
#888995 src:dbus-cpp dbus-cpp: async_execution_load_test fails sometimes (randomly?) 2020-12-13
#890457 src:latrace latrace FTBFS with flex 2.6.4-2 2021-08-16
#891205 src:assword assword FTBFS: assword: command not found 2021-07-31
#891698 apmd apmd: daemon never starts (apm_available is hardcoded to no) 2019-01-28
#891798 src:guacamole-client guacamole-client: CVE-2017-3158 race can cause buffer overflow 2018-11-29
#892288 src:arrayfire arrayfire FTBFS on i386: test segfaults 2021-08-16
#892344 src:literki literki: Please use 'pkg-config' to find FreeType 2 2021-08-16
#892539 src:pdftk pdftk: Depends on GCJ which is going away 2021-08-16
#892587 php-constant-time Not to be released (yet) 2018-03-11
#893023 src:librsl librsl FTBFS with flex 2.6.4-6 2018-06-22
#893031 src:vowpal-wabbit vowpal-wabbit: Baseline violation on i386 and FTBFS on !x86 2018-06-22
#894284 src:android-platform-tools-base android-platform-tools-base FTBFS with openjdk-9 2020-03-20
#894353 src:ikvm ikvm build depends on openjdk-8-jdk 2019-01-28
#894532 src:node-d3-format node-d3-format: Duplicates exisitng node-d3-format binary package 2018-03-31
#894540 src:sbt sbt FTBFS with openjdk-9 2018-06-22
#895513 pstotext pstotext doesn't work any more: Unrecoverable error: undefined in DELAYBIND 2021-08-16
#895823 dovecot-core cannot purge dovecot-common 2018-04-20
#896327 python-sphinxcontrib.rubydomain python-sphinxcontrib.rubydomain: sphinxcontrib.rubydomain fails to import 2021-08-16
#896348 python3-sphinxcontrib.youtube python3-sphinxcontrib.youtube: sphinxcontrib.youtube fails to import 2021-08-16
#896369 python-sphinxcontrib.youtube python-sphinxcontrib.youtube: sphinxcontrib.youtube fails to import 2021-08-16
#896395 python3-sphinxcontrib.rubydomain python3-sphinxcontrib.rubydomain: sphinxcontrib.rubydomain fails to import 2021-08-16
#896580 mixer.app mixer.app: Fails to work with ALSA 2019-04-10
#897707 src:arrayfire arrayfire: ftbfs with GCC-8 2021-08-16
#897723 src:coinor-flopc++ coinor-flopc++: ftbfs with GCC-8 2021-08-16
#897761 src:gnuift gnuift: ftbfs with GCC-8 2021-08-16
#897975 gdm3 gdm3: restarts in a loop: IceLockAuthFile fail: Already exists (race condition?) 2021-08-14
#898453 src:vncterm vncterm: CVE-2018-7226: integer overflow in vcSetXCutTextProc in VNConsole.c 2018-07-17
#898832 src:ecere-sdk ecere-sdk: FTBFS on i386: /usr/lib/gcc/i686-linux-gnu/7/include/stddef.h:435:78: error: syntax error 2021-08-16
#899128 src:kdepim Limit CVE-2017-17689 (EFAIL) for kmail 2019-04-09
#899309 src:autofill-forms autofill-forms: Replace it with non legacy autofillforms-e10 to be compatible with ff 60. 2018-12-05
#899435 src:389-ds-console 389-ds-console: Invalid maintainer address pkg-fedora-ds-maintainers@lists.alioth.debian.org 2021-08-16
#899436 src:389-adminutil 389-adminutil: Invalid maintainer address pkg-fedora-ds-maintainers@lists.alioth.debian.org 2021-08-16
#899437 src:389-admin 389-admin: Invalid maintainer address pkg-fedora-ds-maintainers@lists.alioth.debian.org 2021-08-16
#899438 src:389-admin-console 389-admin-console: Invalid maintainer address pkg-fedora-ds-maintainers@lists.alioth.debian.org 2021-08-16
#899444 src:389-dsgw 389-dsgw: Invalid maintainer address pkg-fedora-ds-maintainers@lists.alioth.debian.org 2021-08-16
#899467 src:cgminer cgminer: Invalid maintainer address pkg-bitcoin-devel@lists.alioth.debian.org 2021-08-16
#899479 src:combat combat: Invalid maintainer address pkg-corba-devel@lists.alioth.debian.org 2021-08-16
#899568 src:libblkmaker libblkmaker: Invalid maintainer address pkg-bitcoin-devel@lists.alioth.debian.org 2018-05-24
#899752 src:yaboot yaboot: Invalid maintainer address debootloaders-yaboot@lists.alioth.debian.org 2021-08-16
#899846 src:literki literki: Invalid maintainer address pkg-fso-maint@lists.alioth.debian.org 2021-08-16
#899908 src:opennebula-context opennebula-context: Invalid maintainer address pkg-opennebula-devel@lists.alioth.debian.org 2021-08-16
#900821 src:linux apache reads wrong data over cifs filesystems served by samba 2021-08-30
#900929 cgminer CVE-2018-10057 CVE-2018-10058 2018-06-06
#901610 sicherboot sicherboot,dracut: conffile problems when installing both 2018-07-19
#901761 pdftk Not installable at amd64 because of libgcj17 dependency 2021-08-16
#901779 src:debirf debirf: autopkgtest fails because script is not executable 2019-07-20
#901952 tar xdelta: expected from file (/tmp/pristine-tar.SljdkfANnj/recreatetarball) of length 7557120 bytes 2020-12-06
#902132 src:falcon falcon: FTBFS since python-networkx version 2.1-1; fails in test suite 2020-11-30
#902162 src:translate-toolkit translate-toolkit: FTBFS in stretch (broken by change in Africa/Windhoek timezone) 2019-08-06
#902452 kamailio-tls-modules Kamailio TLS module in Debian Stretch is unusable 2018-12-31
#902562 src:strace strace: FTBFS in stretch 2018-06-27
#902618 src:why why: needs porting to why3 version 1.0.0 2019-02-23
#902810 src:user-mode-linux user-mode-linux: FTBFS in stretch (Hunk #1 FAILED in 07-remove-rpath.patch) 2018-07-07
#903374 src:tracker tracker: autopkgtest regressed in September 2021 2021-09-22
#903413 src:debbugs debbugs: FTBFS in buster/sid (dh_installdocs: Cannot find "UPGRADE") 2020-12-08
#903514 src:glibc Deadlock in _dl_close join-ing threads accessing TLS 2021-04-10
#903586 src:bind bind: fails to build twice in a row 2018-07-11
#903761 bind bind: fails to install: rndc-confgen: The -r option has been deprecated. 2018-09-24
#903866 python-clang-4.0, python-lldb-4.0 python-{clang,lldb}-4.0: missing Breaks+Replaces against python-clang-3.[45], python-lldb-3.5 2018-11-06
#903937 libtowitoko2 /etc/reader.conf.d/libtowitoko2 causes driver failure 2021-06-02
#903940 libtowitoko2 Integer overflow on buffer sizes causes complete failure of driver 2018-07-17
#904010 src:edb edb: FTBFS in sid (build-depends on emacs24) 2021-08-16
#904118 arriero arriero: arriero.moo fails to import 2019-01-14
#904475 src:mlton mlton: build-depends on the version of itself that is going to be built 2021-08-16
#904742 jp jp: name conflict of /usr/bin/jp with sat-xmpp-jp 2020-05-08
#905417 ants ants: broken symlink: /usr/bin/jointfusion -> ../lib/ants/jointfusion 2018-08-04
#905449 libfsharp-core4.3-cil libfsharp-core4.3-cil: It is impossible to configure libfsharp-core4.3-cil package 2021-08-16
#905782 bdfproxy Invalid dependency to mitmproxy old python2 module 2018-11-28
#906011 pdftk pdftk does not properly attribute iText, may violate GPL 2018-12-11
#906032 src:gnuift FTBFS: LaTeX first run problem. 2018-08-13
#906340 src:bookkeeper bookkeeper: FTBFS in buster/sid (Could not resolve dependencies for project org.apache.bookkeeper:bookkeeper-server:jar:4.4.0) 2021-08-16
#906496 src:obexpushd obexpushd: FTBFS in buster/sid (linux/irda.h: No such file or directory) 2019-07-08
#906500 src:pathspider pathspider: FTBFS in buster/sid (autobuilder hangs) 2019-12-10
#906744 dh-php /usr/lib/php/20151012/yaml.so: cannot open shared object file 2018-10-22
#906835 src:pdf.js xul-ext-pdf.js no longer works with firefox-esr 60 2020-10-22
#906953 src:doc-linux-fr doc-linux-fr: French translations of horribly outdated documentation 2021-08-16
#907308 latrace latrace: every program "killed by signal 11" 2021-04-07
#907691 petri-foo petri-foo: License incompatibility: links with OpenSSL 2018-08-31
#907767 mozplugger mozplugger seems to be useless now 2021-09-13
#907974 src:perl-doc-html perl-doc-html: Should be updated to 5.28 at the point of the transition 2019-07-27
#908017 src:network-manager-iodine network-manager-iodine FTBFS with glib 2.58 2021-04-07
#908056 golang-github-vbatts-tar-split golang-github-vbatts-tar-split: CVE-2017-14992 2018-09-10
#908295 rhc rhc depreated 2021-08-16
#908678 security-tracker security-tracker - Breaks salsa.d.o 2020-10-02
#908947 youtube-dl recent version for stable-(updates|backports) 2020-03-24
#909352 src:squeak-plugins-scratch Is squeak-plugins-scratch still useful? 2021-08-16
#909388 sml-mode sml-mode: fails to install with xemacs21 2018-09-22
#909498 firefox-esr firefox-esr: Firefox 60.2.1esr-1~deb9u1 crashes on armhf with or without safemode, without extensions, fresh profile. 2019-06-27
#909750 libfontconfig1 applications tries to write to /usr/* directories via libfontconfig1 2021-08-14
#909833 src:ants ants FTBFS with gcc 8 2021-08-16
#910468 src:pluto-sat-code pluto-sat-code: FTBFS: dh_installdocs: Cannot find (any matches for) "README.Debian" (tried in .) 2018-10-06
#910813 src:doc-linux-fr doc-linux-fr: FTBFS, latex error "Package inputenc Error: Invalid UTF-8 byte sequence" 2020-09-27
#910861 mate-system-tools Tool for managing users and groups will not start any more 2018-10-15
#910920 tinc tinc: fails to install: tinc.postinst: cannot create /etc/tinc/nets.boot: Directory nonexistent 2021-07-26
#912037 src:ignore-me ignore-me: FTBFS: Race condition in Making install in src 2018-10-27
#912072 src:srg srg: FTBFS with GCC 8 2018-10-28
#912364 el-get el-get: not suitable for stable release 2021-08-16
#912485 src:childsplay childsplay: Please migrate to python3-pygame 2020-10-20
#912682 libextutils-parsexs-perl libextutils-parsexs-perl: version is older than Replaces+Breaks in perl-modules-5.28 2019-06-06
#912924 haskell-classy-prelude-yesod classy-prelude-yesod: not worth maintenance burden? 2018-11-05
#913159 task-kannada-desktop task-kannada-desktop: uninstallable on mips and mipsel 2019-02-16
#913576 grub-efi-amd64 Update to grub-efi-amd64 2.02~beta3-5 results in "error: efibootmgr failed to register the boot entry: Operation not permitted." 2019-05-13
#913719 metche Don't include metche in Buster 2021-10-14
#913800 libpam-elogind-compat libpam-elogind-compat will always be RC-buggy 2018-11-15
#913836 php7.0-imap php7.0-imap: CVE-2018-19518: imap_open() function command injection 2018-12-07
#913916 grub-efi-amd64 grub-efi-amd64: UEFI boot option removed after update to grub2 2.02~beta3-5+deb9u1 2021-08-14
#913978 gnome-control-center is not accessible with Orca screenreader 2021-03-03
#914353 src:hdbc-odbc hdbc-odbc: Missing build-dependency on concurrent-extra 2020-01-24
#914801 evqueue-core evqueue-core: modifies conffiles (policy 10.7.3): /etc/evqueue.conf 2018-11-27
#915041 python3-django-test-without-migrations does not create a subcommand '[test_without_migrations]' 2018-12-01
#915050 src:gitlab Keep out of testing 2020-12-18
#915069 libphp-predis libphp-predis: Useless in Debian, superseded by php-nrk-predis 2021-08-16
#915072 src:keysafe keysafe: build-depends on many no longer available libghc-*-dev versions 2020-07-24
#915365 www.debian.org historical.packages.debian.org: 404 for any page other than root 2021-09-22
#915504 sbt sbt: Fails to detect version of java 2019-12-04
#915711 src:mldemos mldemos FTBFS against opencv 3.4.4 in experimental 2021-08-16
#915837 camping camping: FTBFS with rails 5.2 2021-08-16
#916132 src:hepmc hepmc FTBFS: FAIL testWeights 2018-12-10
#916716 live-wrapper live-wrapper: Replace vmdebootstrap usage with alternative 2021-08-16
#916832 src:gcc-6 gcc-6: keep out of testing 2018-12-21
#916857 el-get el-get: fails to install with xemacs21 2018-12-19
#916876 src:sdic sdic: FTBFS with Emacs 26.1: Symbol's value as variable is void: default-fill-column 2018-12-20
#916909 libnvtt2 libnvtt2/experimental: nvtt::InputOptions::setTextureLayout(nvtt::TextureType, int, int, int) removed without SONAME bump 2019-01-17
#916936 src:cloop Fails to build against Linux 4.11+ 2021-08-16
#917526 src:libxsmm libxsmm: CVE-2018-20541 CVE-2018-20542 2019-01-03
#917644 src:mlton FTBFS: segmentation faults in test suite 2021-09-22
#917677 src:python-django-push-notifications python-django-push-notifications: FTBFS: dh_auto_test: pybuild --test -i python{version} -p 3.7 --system=custom "--test-args={interpreter} tests/runtests.py" returned exit code 13 2021-08-16
#917829 src:python-intbitset python-intbitset: FTBFS when built with dpkg-buildpackage -A 2019-10-22
#918495 php5-intl php5-intl: php intl does not show in modules from get_load_extensions 2019-01-06
#918519 src:libi8x libi8x: FTBFS on mips(el): Test calling a native function. ... Bus error 2019-01-06
#918984 src:fuse3 fuse3: provide upgrade path fuse -> fuse3 for bookworm 2021-05-08
#919035 elpa-persp-projectile elpa-persp-projectile: broken with recent elpa-perspective 2019-01-12
#919037 xmms2-scrobbler xmms2-scrobbler: Non-working maintainer address 2019-01-12
#919058 itstool its-tools: crashes when freeing xmlDocs 2021-08-21
#919246 oss4-dkms oss4-dkms: module FTBFS for Linux 4.19 2021-02-28
#919296 git-daemon-run git-daemon-run: fails with 'warning: git-daemon: unable to open supervise/ok: file does not exist' 2021-04-10
#919348 xfce4-screensaver xfce4-screensaver: Accidental upload to unstable while fixing bug #919151 2021-02-04
#919769 firefox-esr firefox-esr: OB Firefox 60.4 crashes immediately on amrhf (Raspberry Pi) 2020-04-29
#919914 gnome-settings-daemon gnome-tweaks now equates "don't suspend on lid close" with "don't lock on lid close" (security issue) 2021-04-10
#920481 src:openhft-chronicle-wire openhft-chronicle-wire: FTBFS: uses deprecated classes/methods 2020-09-27
#921549 src:golang-1.8 golang-1.8: Security update of golang-1.8 breaks pieces of cgo pkg-config support 2019-02-06
#921672 auto-complete-el auto-complete-el: 1.3.1-2+deb9u1 causes regression in gocode-auto-complete-el 2019-02-07
#921904 src:win-iconv win-iconv: FTBFS (wine: chdir to /tmp/wine-I6miLw/server-29-3583b06 : No such file or directory) 2021-08-16
#922214 libpng12-0 libpng12-0: libpng12.so.0 can not be installed, file or directory not found 2020-12-12
#922223 apt apt: terminate called after throwing an instance of 'std::logic_error' ... Aborted 2019-03-04
#922344 src:bareos bareos: autopkgtest regression 2019-07-17
#922396 webext-noscript webext-noscript: version out of date -- does not work with current Firefox 2020-09-06
#922420 gandi-cli <command> got an unexpected keyword argument 'bg' 2020-02-06
#922504 src:socket-activate socket-activate: FTBFS in sid (failing tests) 2019-02-17
#922579 src:freeture FTBFS against opencv 4.0.1 (exp) 2021-08-16
#922584 src:limereg FTBFS against opencv 4.0.1 (exp) 2021-08-16
#922585 src:mldemos FTBFS against opencv 4.0.1 (exp) 2021-08-16
#922981 ca-certificates-java ca-certificates-java: /etc/ca-certificates/update.d/jks-keystore doesn't update /etc/ssl/certs/java/cacerts 2021-08-14
#923330 jajuk jajuk: Fails to start with Java Runtime Environment 1.7 minimum required. You use a JVM ext.JVM@23fc625e 2019-08-27
#923347 src:mysql-connector-python No sensible security support due to Oracle's policies 2019-11-18
#924109 diaspora diaspora: fails to install noninteractively 2019-03-09
#924151 grub2-common grub2-common: wrong grub.cfg for efi boot and fully encrypted disk 2021-08-14
#924233 obs-server obs-server: fails to purge: delgroup: `obsservicerun' still has `obsrun' as their primary group! 2019-03-19
#924325 src:gcc-8-cross gcc-8-cross: FTBFS because of Makefile bug: ../../gnatbind: No such file or directory 2020-12-22
#924731 src:phamm phamm: CVE-2018-20806: Reflected XSS in Phamm login page 2020-01-02
#924764 src:mingw-ocaml mingw-ocaml: FTBFS (cp: cannot stat 'objinfo_helper': No such file or directory) 2021-08-16
#924774 src:openhft-chronicle-network openhft-chronicle-network: FTBFS: cannot find symbol 2020-09-27
#924816 src:mingw-ocaml mingw-ocaml: FTBFS: hasgot.c:(.text+0x13): undefined reference to `tgetent' 2021-08-16
#924970 src:openhft-chronicle-threads openhft-chronicle-threads: FTBFS: package net.openhft.chronicle.core.threads does not exist 2020-09-27
#925134 grub-efi-amd64 grub-efi-amd64-signed: doesn't mount cryptodisk 2021-08-14
#925269 redmine-plugin-recaptcha redmine-plugin-recaptcha: breaks configuration of redmine 2019-03-21
#925523 src:openhft-chronicle-bytes openhft-chronicle-bytes: FTBFS package net.openhft.chronicle.core.cleaner does not exist 2020-09-27
#925657 src:condor condor: ftbfs with GCC-9 2021-08-16
#925676 src:faumachine faumachine: ftbfs with GCC-9 2021-08-16
#925681 src:firefox-esr firefox-esr: ftbfs with GCC-9 2021-08-16
#925834 src:spd spd: ftbfs with GCC-9 2021-08-16
#926275 guacamole Depends on tomcat8 2021-08-16
#926276 src:guacamole-client Should guacamole-client be removed? 2021-08-16
#927124 minitube minitube: Minitube version in Debian Stable it's too old and doesn't work anymore. 2020-10-04
#927137 src:tumgreyspf src:tumgreyspf: Please port to python3 or remove 2021-08-16
#927747 samba bind9_dlz backend is entirely broken in Debian 2019-10-25
#927931 src:bind bind: CVE-2019-6467: An error in the nxdomain redirect feature can cause BIND to exit with an INSIST assertion failure in query.c 2019-04-25
#927935 src:bind bind: CVE-2018-5743: Limiting simultaneous TCP clients is ineffective 2019-04-25
#928175 postfix postfix: [Regression/Stretch] No more delivers mails to mailboxes > ca. 500 MB via procmail since upgrade from 3.1.9-0+deb9u2 to 3.1.12-0+deb9u1 2019-09-23
#928422 rust-doc rust-doc: unsatisfiable Depends: fonts-open-sans in jessie, stretch 2021-03-22
#929165 ubuntu-keyring ubuntu-keyring removes configuration files without checking 2021-03-14
#929685 ca-certificates-java, default-jre-headless, openjdk-11-jre-headless ca-certificates-java,default-jre-headless,openjdk-11-jre-headless: get rid of the circular dependency 2021-08-14
#929713 src:openhft-chronicle-bytes openhft-chronicle-bytes: FTBFS: [ERROR] /<<PKGBUILDDIR>>/src/main/java/net/openhft/chronicle/bytes/NativeBytesStore.java:[78,48] cannot find symbol 2021-08-16
#929983 ipxe-qemu ipxe-qemu: virtio booting broken past jessie 2021-04-10
#930747 src:bind bind: CVE-2019-6471: A race condition when discarding malformed packets can cause BIND to exit with an assertion failure 2019-06-19
#930874 ctop [ERROR] Failed to locate cgroup mountpoints. 2021-03-17
#930910 python-musicbrainz2 python-musicbrainz2: MusicBrainz API V1 is turned off 2019-06-22
#930991 gajim gajim in Debian stretch does not start anymore 2021-09-13
#931002 src:rust-coresimd rust-coresimd: FTBFS (unrecognized platform-specific intrinsic function: `x86_rdrand16_step`unrecognized platform-specific intrinsic function: `x86_rdrand16_step`) 2019-09-08
#931003 src:rust-simd rust-simd: FTBFS (unrecognized platform-specific intrinsic function: `x86_mm_movemask_ps`unrecognized platform-specific intrinsic function: `x86_mm_movemask_ps`) 2021-05-09
#931281 gnome-shell gnome-shell: Session cannot be unlocked when audio dialog for plugged in speaker is active 2019-06-30
#931519 wajig wajig: upgradesecurity references testing/updates instead of testing-security 2021-09-23
#931756 bindgraph bindgraph stop action fails 2019-07-10
#932085 grub-common grub-common: Grub can't load initrd for Xen after upgrade to Buster 2021-04-22
#932501 src:squid-deb-proxy squid-deb-proxy: daemon does not start due to the conf file not being allowed by apparmor 2021-08-19
#932631 src:argus-client argus-client ftbfs in unstable 2021-08-16
#933751 mini-buildd mini-buildd (build-)depends on cruft package. 2021-09-07
#933757 firefox-esr Firefox-esr FTBFS "failed to open: /sbuild-nonexistent/.cargo/.package-cache" 2019-08-15
#933981 cdrom cdrom: USB, KVM create connect/disconnect loop in level1 (repair) install 2019-08-05
#934036 src:sketch sketch: FTBFS in stretch (LaTeX error) 2019-08-06
#934242 src:crystalhd crystalhd: unusable without (available and properly working) firmware 2021-03-12
#934341 guayadeque guayadeque: broken due to mixed used of gtk2 and gtk3 2019-08-10
#934839 python-keepkey python-keepkey: depends on cruft package. 2021-08-16
#934977 src:verilog-mode verilog-mode: unbuildable in testing due to missing B-D emacs25 2021-08-16
#935088 libgif7 libgif7: ABI break in 5.2 - GifQuantizeBuffer 2019-08-19
#935182 libreoffice-core Concurrent file open on the same host results file deletion 2021-04-10
#935246 php-patchwork-utf8 Useless in Debian 2021-08-16
#935271 src:lua-apr lua-apr: FTBFS on all architectures 2021-08-16
#935279 src:erlang-cuttlefish erlang-cuttlefish: FTBFS on amd64 2021-08-16
#935282 src:libretro-mupen64plus libretro-mupen64plus: FTBFS on armhf 2021-08-16
#935286 src:mongo-tools mongo-tools: FTBFS on amd64 2021-08-16
#935384 phpunit-git Abandoned upstream 2021-08-16
#935639 phpunit-dbunit Abandoned upstream 2021-08-16
#935669 assaultcube-data assaultcube-data: Outdated version makes assaultcube uninstallable 2021-08-16
#936159 src:astk astk: Python2 removal in sid/bullseye 2021-08-16
#936185 src:bareos bareos: Python2 removal in sid/bullseye 2021-08-16
#936241 src:broctl broctl: Python2 removal in sid/bullseye 2021-08-16
#936268 src:caldav-tester caldav-tester: Python2 removal in sid/bullseye 2021-08-16
#936298 src:childsplay childsplay: Python2 removal in sid/bullseye 2020-10-20
#936303 src:cinfony cinfony: Python2 removal in sid/bullseye 2020-07-08
#936459 src:dvcs-autosync dvcs-autosync: Python2 removal in sid/bullseye 2021-08-16
#936503 src:falcon falcon: Python2 removal in sid/bullseye 2020-11-30
#936535 src:flup flup: Python2 removal in sid/bullseye 2021-08-16
#936564 src:fsl fsl: Python2 removal in sid/bullseye 2021-08-16
#936593 src:geda-gaf geda-gaf: Python2 removal in sid/bullseye 2021-02-10
#936619 src:gjots2 gjots2: Python2 removal in sid/bullseye 2021-08-16
#936624 src:gnat-gps gnat-gps: Python2 removal in sid/bullseye 2021-08-16
#936638 src:googlefontdirectory-tools googlefontdirectory-tools: Python2 removal in sid/bullseye 2021-08-16
#936665 src:grokmirror grokmirror: Python2 removal in sid/bullseye 2021-08-16
#936700 src:hgsubversion hgsubversion: Python2 removal in sid/bullseye 2021-08-16
#936765 src:jinja2 jinja2: Python2 removal in sid/bullseye 2021-08-16
#936777 src:k3d k3d: Python2 removal in sid/bullseye 2020-07-08
#936785 src:ketchup ketchup: Python2 removal in sid/bullseye 2021-08-16
#936809 src:kross-interpreters kross-interpreters: Python2 removal in sid/bullseye 2021-08-16
#936812 src:ladish ladish: Python2 removal in sid/bullseye 2021-08-16
#936854 src:libewf libewf: Python2 removal in sid/bullseye 2021-08-16
#936869 libgnatcoll-python libgnatcoll-bindings: Python2 removal in sid/bullseye 2021-08-16
#936935 src:libvirt-sandbox libvirt-sandbox: Python2 removal in sid/bullseye 2021-09-15
#936945 src:lightyears lightyears: Python2 removal in sid/bullseye 2021-03-29
#936954 src:live-wrapper live-wrapper: Python2 removal in sid/bullseye 2021-08-16
#936955 src:lizardfs lizardfs: Python2 removal in sid/bullseye 2020-08-02
#937049 src:mini-buildd mini-buildd: Python2 removal in sid/bullseye 2021-08-16
#937054 src:mklibs mklibs: Python2 removal in sid/bullseye 2021-08-16
#937125 src:neard neard: Python2 removal in sid/bullseye 2021-08-16
#937138 src:nglister nglister: Python2 removal in sid/bullseye 2021-08-16
#937194 src:opencaster opencaster: Python2 removal in sid/bullseye 2021-08-16
#937266 src:pd-py pd-py: Python2 removal in sid/bullseye 2020-07-08
#937312 src:postnews postnews: Python2 removal in sid/bullseye 2020-08-02
#937398 src:pycalendar pycalendar: Python2 removal in sid/bullseye 2021-08-16
#937869 src:python-keepkey python-keepkey: Python2 removal in sid/bullseye 2021-08-16
#937927 src:python-mode python-mode: Python2 removal in sid/bullseye 2021-08-16
#937940 src:python-nemu python-nemu: Python2 removal in sid/bullseye 2021-08-16
#937945 src:python-neuroshare python-neuroshare: Python2 removal in sid/bullseye 2021-08-16
#938001 src:python-passfd python-passfd: Python2 removal in sid/bullseye 2021-08-16
#938036 src:python-pmw python-pmw: Python2 removal in sid/bullseye 2021-08-16
#938241 src:python-unshare python-unshare: Python2 removal in sid/bullseye 2021-08-16
#938351 src:renpy renpy: Python2 removal in sid/bullseye 2020-10-27
#938432 src:sandsifter sandsifter: Python2 removal in sid/bullseye 2020-08-02
#938509 src:snowballz snowballz: Python2 removal in sid/bullseye 2021-08-16
#938516 src:sortsmill-tools sortsmill-tools: Python2 removal in sid/bullseye 2021-08-16
#938544 src:sphinx-patchqueue sphinx-patchqueue: Python2 removal in sid/bullseye 2021-08-16
#938628 src:taskd taskd: Python2 removal in sid/bullseye 2021-10-21
#938637 src:telepathy-gabble telepathy-gabble: Python2 removal in sid/bullseye 2021-02-25
#938754 src:undertaker undertaker: Python2 removal in sid/bullseye 2021-08-16
#938774 src:viewmol viewmol: Python2 removal in sid/bullseye 2021-08-16
#938790 src:vland vland: Python2 removal in sid/bullseye 2021-08-16
#938792 src:vmdebootstrap vmdebootstrap: Python2 removal in sid/bullseye 2021-08-16
#938794 src:vmm vmm: Python2 removal in sid/bullseye 2021-08-16
#938795 src:vmtk vmtk: Python2 removal in sid/bullseye 2021-08-16
#938850 src:xmlelements xmlelements: Python2 removal in sid/bullseye 2021-08-16
#938921 src:zorp zorp: Python2 removal in sid/bullseye 2021-08-16
#939065 src:cinfony BD on python-rdkit which isn't build anymore and isn't in bullseye 2021-08-16
#939147 ftp.debian.org gcc-7-source 7.4.0-11 vanished from the archive 2021-07-18
#939323 src:haskell-serialise haskell-serialise: huge build logs 2020-05-03
#939377 citadel-server citadel-server: After installation: Webcit cannot connect, server hangs 2019-11-25
#939660 src:field3d src:field3d: autopkgtest fails if package is rebuilt against ilmbase 2.3.0 2021-08-16
#939741 src:coq-doc FTBFS with OCaml 4.08.0 (safe strings) 2019-11-06
#939763 src:sphinxsearch sphinxsearch: Still maintained (same version since stretch)? 2021-08-16
#939940 src:libvirt-sandbox libvirt-sandbox: missing python build-dependency causes FTBFS with gtk-doc-tools 1.32 2021-08-16
#940017 src:crypto-policies crypto-policies: Incomplete debian/copyright? 2020-07-05
#940139 nautilus nautilus: open files by double clicking or right click "open" 2019-09-12
#940275 php-cache-lite FTBFS with recent PHPUnit (8) 2021-08-16
#941101 src:rdup rdup: Uses functions deprecated in Nettle 3.5 2019-11-05
#941264 php-cache-lite phpunit breaks php-cache-lite autopkgtest: tries to write to /usr/bin/.phpunit.result.cache 2021-08-16
#941453 src:vibe.d vibe.d: FTBFS with libphobos2-ldc-shared86 2021-08-16
#941531 gsl-doc gsl-doc: build-depend on texlive-plain-generic, not obsolete texlive-generic-recommended 2021-08-16
#941714 src:bst-external bst-external: file conflict: installs .coverage file 2021-01-31
#941829 inform-mode inform-mode: Can't type right bracket; complains about last-command-char 2019-10-06
#942064 src:profphd profphd: autopkgtest failure 2021-08-16
#942281 libapache2-mod-ruid2 libapache2-mod-ruid2 package missing 2019-10-14
#942622 src:lightyears src:lightyears: Maintainer email address not working 2021-09-16
#942737 libapache2-mod-gnutls libapache2-mod-gnutls: mod_gnutls consumes 100% cpu 2020-11-29
#942964 src:avw.lv2 avw.lv2: Python2 removal in sid/bullseye 2021-08-16
#942988 src:displaycal displaycal: Python2 removal in sid/bullseye 2021-03-02
#943037 src:git-hub git-hub: Python2 removal in sid/bullseye 2020-12-08
#943251 src:ruby-license-finder ruby-license-finder: Python2 removal in sid/bullseye 2021-08-16
#943266 src:xdeb xdeb: Python2 removal in sid/bullseye 2021-08-16
#943306 src:rust-cargo-lichking rust-cargo-lichking: build-dependency not satisfiable 2021-08-16
#943307 src:hurd hurd: build-dependency unsatisfiable 2019-10-23
#943332 src:aufs-tools aufs-tools FTBFS: aufs-util for aufs4.14 20190211, but aufs is 5.2.5+-20190909. 2021-08-16
#943405 sopel unsuitable for release: no upstream patch releases 2021-02-01
#943479 src:haskell-werewolf FTBFS with ghc-8.6.5 2021-08-16
#943578 src:fluxbox fluxbox: FTBFS due to undefined references 2019-10-26
#943607 pkg-mozilla-archive-keyring pkg-mozilla-archive-keyring: Key expires soon (2019-11-13) 2021-01-02
#943690 src:sphinxcontrib-youtube src:sphinxcontrib-youtube: Maintainer email address not working 2019-11-02
#944016 orangeassassin orangeassassin: depends on no longer available python3-raven 2019-11-02
#944030 src:jinja2-time jinja2-time: FTBFS in unstable 2020-10-22
#944275 hollywood hollywood: contains non-free music 2020-03-31
#944499 src:fonts-alegreya-sans FTBFS: IndexError: list index out of range 2021-08-16
#944542 aws-shell aws-shell: prompt_toolkit 3.x support 2021-09-05
#944626 src:diet-ng diet-ng FTBFS on armhf: gdc: error: unrecognized command line option ‘-main’; did you mean ‘-Wmain’? 2021-08-16
#944658 src:mailavenger mailavenger: FTBFS on i386 2020-04-03
#944693 mailavenger mailavenger: license incompatibility between 4-clause BSD and GPL 2020-04-03
#944697 ftp.debian.org security.debian.org: please bring back MD5Sum, at least for buster/updates 2021-07-18
#944706 firefox-esr firefox-esr: Tab crashes immediately after start up and Firefox ESR was unusable. 2020-02-03
#944871 src:docbook-xsl docbook-xsl: readds catalogs to the super catalog on every upgrade 2021-04-22
#945001 grub-efi-amd64 grub-efi-amd64: GRUB-EFI messes up boot variables 2021-08-14
#945242 src:libfile-rsyncp-perl libfile-rsyncp-perl misses source for FileList/configure 2019-11-21
#945254 src:py-libzfs py-libzfs: FTBFS against python3.8 2021-06-15
#945625 src:cicero cicero: Python2 removal in sid/bullseye 2020-07-08
#945663 src:drbdlinks drbdlinks: Python2 removal in sid/bullseye 2021-08-16
#945666 src:mlucas mlucas: Python2 removal in sid/bullseye 2021-08-16
#945677 src:git-notifier git-notifier: Python2 removal in sid/bullseye 2021-08-16
#945742 src:urjtag urjtag: Python2 removal in sid/bullseye 2021-08-16
#945748 src:xboxdrv xboxdrv: Python2 removal in sid/bullseye 2021-08-16
#946039 picprog picport: Will crash with Linux 5.5 due to cli 2021-08-16
#946228 src:k3d FTBFS with CGAL 5.0 2021-08-16
#946352 src:gcc-9-cross-mipsen gcc-9-cross-mipsen_2+c1+b1_i386.changes REJECTED 2019-12-08
#946380 wicd-gtk wicd-gtk does not find gtk modules 2021-03-29
#946412 src:janus janus-gateway: upstream does not support stable releases 2021-04-22
#946452 src:mpqc3 mpqc3: FTBFS in sid 2021-08-16
#947039 libapache2-mod-auth-pgsql libapache2-mod-auth-pgsql: AuthType Basic configured without corresponding module 2019-12-19
#947111 src:python-thinc python-thinc: FTBFS with Python 3.8 2021-08-16
#947277 src:arriero arriero: missing Build-Depends: dh-python 2019-12-23
#947278 src:xmlelements xmlelements: missing Build-Depends: dh-python 2021-07-26
#947346 php-fig-link-util Useless in Debian 2019-12-25
#947425 incron incron crashes in IncronTabEntry::GetSafePath due to use-after-free bug 2019-12-26
#947437 src:flang flang: Please update to llvm-9 2021-03-02
#947443 src:nvidia-texture-tools nvidia-texture-tools: FTBFS: undefined reference to symbol '_ZN2nv3Fit37computePrincipalComponent_EigenSolverEiPKNS_7Vector4E' 2019-12-26
#947510 asterisk-espeak Asterisk won't response for a while after run the TTS for the first time. 2020-03-28
#947518 src:casparcg-server casparcg-server: FTBFS: xf86vmode library not found - required for GLFW 2021-08-16
#947521 src:florence florence: build-depends on deprecated gnome-doc-utils 2021-08-16
#947523 src:gconf-editor gconf-editor: build-depends on deprecated gnome-doc-utils 2021-08-16
#947540 src:stardict stardict: build-depends on deprecated gnome-doc-utils 2021-10-18
#947551 prospector prospector: please, tighten the dependency of prospector on python3-pep8-naming 2020-06-22
#947586 src:xorp FTBFS with scons 3.1.2-1 2021-08-16
#947649 src:pangox-compat pangox-compat: deprecated since 2012, unmaintained, should probably be removed 2021-08-16
#947878 src:gnome-mime-data gnome-mime-data: unmaintained upstream for over a decade 2021-10-21
#948087 src:aufs aufs build depends on the removed linux-kbuild-5.2 2020-06-20
#948127 src:k3d [k3d] FTBFS with boost1.71 2021-08-16
#948244 tracker.debian.org tracker.debian.org has off-by-one in the releases for packages not in stable 2020-12-04
#948318 openssh-server openssh-server: Unable to restart sshd restart after upgrade to version 8.1p1-2 2021-08-14
#948602 openturns-examples openturns-examples has a hard-coded dependency on python 2021-08-16
#948632 src:rust-bcder rust-bcder: Build-depends on older rust-smallvec than is in unstable 2021-03-01
#948683 ruby-aws-sdk ruby-aws-sdk: pakage is broken 2020-01-11
#948739 gparted gparted should not mask .mount units 2021-08-14
#948875 src:ignore-me ignore-me: FTBFS: dh: unable to load addon python3 2021-04-02
#948987 kopete kopete: segfaults when is using it (libjingle-call) 2020-01-16
#949016 php-doctrine-cache-bundle Useless in Debian 2020-01-16
#949264 movit nageru: FTBFS on arm/i386/mipsel architectures 2020-01-25
#949355 src:simpleitk simpleitk FTBFS: test failures 2021-08-16
#949519 sudo-ldap sudo-ldap: Fails to connect to LDAP : "ldap_sasl_bind_s(): Can't contact LDAP server" 2021-08-14
#949532 src:medialibrary medialibrary: keep out of testing until vlc uses it 2020-01-21
#949537 elpa-elfeed-web elpa-elfeed-web: depends on CSS and JavaScript not in Debian 2020-05-06
#949570 src:dropwatch dropwatch should not use the private binutils shared libraries 2021-08-16
#949603 src:boinc-app-eah-brp boinc-app-eah-brp should not use the private binutils shared libraries 2021-08-16
#949756 src:staticsite staticsite FTBFS: FAIL: test_site (tests.test_page_filter.TestPageFilter) 2020-04-11
#949767 src:clblas clblas: *gemm wrong answers in out-of-order queues 2021-08-16
#949937 src:dirspec dirspec build depends on the removed pep8 transitional package 2020-01-27
#949942 src:backup2swift backup2swift build depends on the removed pep8 transitional package 2020-01-27
#950059 src:python-lepl python-lepl: missing build dependency on dh-python 2020-01-28
#950168 pstack pstack always fails with "crawl: Input/output error" 2020-02-01
#950372 src:radare2 Is radare2 suitable for stable Debian releases? 2020-02-08
#950598 python3-jupyter-sphinx python3-jupyter-sphinx: package relies on unavailable `ipywidgets.embed` module 2021-10-14
#950926 ember ember: Using packages to install "snap" packages is not a correct use of the packaging system 2020-02-25
#950999 src:libkiokudb-perl libkiokudb-perl: FTBFS with recent YAML* packages 2020-02-24
#951248 src:origami-pdf origami-pdf: autopkgtest failure: output to stderr: warning: constant ::Bignum is deprecated 2021-08-16
#951683 src:rust-selectors rust-selectors: build-depends on non-existing librust-cssparser-0.25+default-dev 2021-03-01
#951888 src:python-enable python-enable FTBFS with swig 4.0.1 2021-06-21
#952059 src:mxt-app mxt-app: FTBFS: src/test/run_unit_tests.h:32: error: "assert_float_equal" redefined [-Werror] 2021-08-16
#952137 src:rust-tokio-core rust-tokio-core: FTBFS: build-dependency not installable: librust-scoped-tls-0.1+default-dev 2021-08-16
#952157 src:verdigris verdigris FTBFS with Qt 5.12 2021-08-16
#952159 src:rust-nodrop-union rust-nodrop-union: FTBFS: dh_auto_test: error: /usr/share/cargo/bin/cargo build returned exit code 101 2021-08-16
#952169 src:libmodule-starter-plugin-cgiapp-perl libmodule-starter-plugin-cgiapp-perl: FTBFS: dh_auto_test: error: perl Build test --verbose 1 returned exit code 1 2021-08-16
#952229 src:libkiokudb-backend-dbi-perl libkiokudb-backend-dbi-perl: FTBFS: dh_auto_test: error: make -j4 test TEST_VERBOSE=1 returned exit code 2 2021-08-16
#952259 src:navi2ch navi2ch: FTBFS: Malformed UTF-8 character (fatal) at /usr/share/texinfo/Texinfo/ParserNonXS.pm line 3387. 2021-08-16
#952290 src:libinnodb libinnodb: FTBFS: dh: error: The --until option is not supported any longer (#932537). Use override targets instead. 2021-08-16
#952299 src:golang-go-dbus golang-go-dbus: FTBFS: failed to initialize build cache at /sbuild-nonexistent/.cache/go-build: mkdir /sbuild-nonexistent: permission denied 2021-08-16
#952310 src:marionnet marionnet: FTBFS: Error: This expression has type bytes but an expression was expected of type string 2021-08-16
#952583 mps-youtube mps-youtube: Mps-youtube failes to find anything because google disabled its api key... and a 2 more minor issues 2020-02-26
#952616 src:ruby-concurrent-ext ruby-concurrent-ext: FTBFS: ERROR: Test "ruby2.5" failed. 2021-08-16
#952692 src:xcffib xcffib: tests sometimes timeout on s390x 2021-04-10
#953032 x11-xkb-utils xkbcomp: Internal error: Could not resolve keysym XF86FullScreen 2021-09-14
#953144 origami origami install fails with "ERROR: WGET RETRIEVAL FAILED!" 2020-04-23
#953224 src:golang-github-xanzy-go-gitlab golang-github-xanzy-go-gitlab: autopkgtest failure: certificate signed by unknown authority 2020-03-06
#953226 src:vagrant-bindfs vagrant-bindfs: autopkgtest failure: cannot load such file -- /tmp/<...>/src/spec/vagrantfile_helper 2020-03-06
#953258 python3-hug-doc python3-hug-doc: missing Breaks+Replaces: python3-hug (<< 2.4.1) 2020-07-14
#953326 src:axtls axtls: CVE-2019-9689 CVE-2019-10013 2020-03-07
#953380 rpmlint rpmlint: Autopkgtest error (test failure) 2020-03-08
#953630 src:openbabel openbabel autopkg tests fail on non-amd64 architectures 2021-06-18
#953967 src:grip grip: autopkgtest failure with Python 3.8 as default 2021-08-16
#954189 acmetool acmetool: Buster acmetool stops working in June 1, 2020 2020-10-06
#954514 src:golang-gopkg-mcuadros-go-syslog.v2 golang-gopkg-mcuadros-go-syslog.v2: FTBFS: dh_auto_test: error: cd obj-x86_64-linux-gnu && go test -vet=off -v -p 4 gopkg.in/mcuadros/go-syslog.v2 gopkg.in/mcuadros/go-syslog.v2/format gopkg.in/mcuadros/go-syslog.v2/internal/syslogparser gopkg.in/mcuadros/go-syslog.v2/internal/syslogparser/rfc3164 gopkg.in/mcuadros/go-syslog.v2/internal/syslogparser/rfc5424 returned exit code 1 2021-08-16
#954519 src:tendermint-log15 tendermint-log15: FTBFS: dh_auto_test: error: cd obj-x86_64-linux-gnu && go test -vet=off -v -p 1 github.com/tendermint/log15 github.com/tendermint/log15/ext github.com/tendermint/log15/term returned exit code 1 2021-08-16
#954531 src:hgsubversion hgsubversion: FTBFS: dpkg-buildpackage: error: dpkg-source -b . subprocess returned exit status 2 2021-08-16
#954554 src:python-asynctest python-asynctest: incompatible with Python 3.8 2021-08-16
#954560 src:debdry debdry: FTBFS: dh_auto_test: error: pybuild --test -i python{version} -p "3.7 3.8" returned exit code 13 2021-08-16
#954636 src:kismet kismet: FTBFS: socket.h:285:33: error: flexible array member ‘cmsghdr::__cmsg_data’ not at end of ‘struct<unnamed>’ 2021-08-16
#954648 rivet FTBFS with Boost 1.71 2020-06-02
#954680 src:jquery-at.js jquery-at.js: FTBFS: The following tasks did not complete: coffee 2021-08-16
#954903 crtmpserver Can not show any vod stream in client 2020-03-25
#955055 src:python-simpy python-simpy: FTBFS with Sphinx 2.4: KeyError: 'python' 2020-04-15
#955558 node-jquery.waitforimages node-jquery.waitforimages broken Uncaught TypeError: Cannot read property 'dataset' of null 2020-04-02
#956000 src:gtk-gnutella gtk-gnutella: missing source for Configure 2020-04-05
#956159 wicd-gtk Package depends on python-glade2 python-gtk2, which are no longer in sid 2021-08-16
#956336 src:bkchem depends on python-pil which is being removed in bullseye (testing) 2021-08-16
#956712 emacs emacs: https to plain http downgrade after unhandled GNUTLS_E_AGAIN error in TLS1.3 connection 2021-02-22
#956949 src:elektra elektra build depends on cruft package swig3.0 2020-04-17
#957080 src:cernlib cernlib: ftbfs with GCC-10 2021-08-16
#957123 src:dballe dballe: ftbfs with GCC-10 2021-08-16
#957161 src:echoping echoping: ftbfs with GCC-10 2021-08-16
#957209 src:flang flang: ftbfs with GCC-10 2021-08-16
#957230 src:freebsd-buildutils freebsd-buildutils: ftbfs with GCC-10 2021-08-16
#957313 src:grsync grsync: ftbfs with GCC-10 2021-08-16
#957366 src:intercal intercal: ftbfs with GCC-10 2021-04-25
#957392 src:juman juman: ftbfs with GCC-10 2021-08-30
#957397 src:kannel-sqlbox kannel-sqlbox: ftbfs with GCC-10 2021-08-16
#957501 src:looptools looptools: ftbfs with GCC-10 2021-08-16
#957514 src:mailavenger mailavenger: ftbfs with GCC-10 2021-08-16
#957522 src:mclibs mclibs: ftbfs with GCC-10 2021-08-16
#957547 src:mlucas mlucas: ftbfs with GCC-10 2021-08-16
#957557 src:mod-gearman mod-gearman: ftbfs with GCC-10 2021-08-16
#957573 src:mz mz: ftbfs with GCC-10 2021-08-16
#957588 src:nekobee nekobee: ftbfs with GCC-10 2021-08-17
#957639 src:openmx openmx: ftbfs with GCC-10 2021-08-16
#957737 src:quagga quagga: ftbfs with GCC-10 2021-08-16
#957758 src:restbed restbed: ftbfs with GCC-10 2021-08-16
#957817 src:smbc smbc: ftbfs with GCC-10 2021-08-16
#957838 src:spout spout: ftbfs with GCC-10 2021-08-16
#957892 src:ucarp ucarp: ftbfs with GCC-10 2021-08-16
#958029 src:imip-agent imip-agent: build-depends on removed packages: python-babel python-psycopg2 2021-03-06
#958117 src:uglifyjs uglifyjs: dead code: keep away from bullseye 2021-01-19
#958362 src:pdfrw pdfrw: fails with python 3.7+ -- abandoned upstream 2021-10-01
#958581 src:bit-babbler bit-babbler: Build-Depends on deprecated dh-systemd which is going away 2021-08-16
#958587 src:lockdown lockdown: Build-Depends on deprecated dh-systemd which is going away 2021-08-16
#958600 src:xorp xorp: Build-Depends on deprecated dh-systemd which is going away 2021-08-16
#958605 src:niceshaper niceshaper: Build-Depends on deprecated dh-systemd which is going away 2021-08-16
#958618 src:mod-gearman mod-gearman: Build-Depends on deprecated dh-systemd which is going away 2021-08-16
#958623 src:tcpcrypt tcpcrypt: Build-Depends on deprecated dh-systemd which is going away 2021-08-16
#958682 node-jsonld node-jsonld: Remove dependency to node-request 2021-03-18
#959149 kea-dhcp4-server kea-dhcp4-server: unable to open '/var/lib/lib/kea/kea-leases4.csv' 2020-04-29
#959193 src:libperl5i-perl libperl5i-perl: Test failures with Devel::Declare 0.006022-1 2020-04-30
#959557 src:ruby-omniauth-remote-user ruby-omniauth-remote-user: FTBFS: ERROR: Test "ruby2.7" failed: NoMethodError: undefined method `strip' for nil:NilClass 2021-08-16
#959571 src:ruby-psych ruby-psych: FTBFS: LoadError: no such file to load -- psych 2021-08-16
#959600 src:jruby jruby: FTBFS: [exec] Failure/Error: return gem_original_require(path) 2021-08-16
#959644 src:isso isso: FTBFS: TypeError: Jade:1 2021-08-16
#959741 gnome-shell-extension-tilix-shortcut gnome-shell-extension-tilix-shortcut: it does not appear in Nautilus contextual menu 2020-05-04
#960223 taskd taskd: Unsuitable for stable release 2021-08-16
#960576 src:pyfg pyfg FTBFS with python3-pip 20.1 2020-05-14
#960679 src:fontconfig fontconfig: strict dependency of arch:any libfontconfig1 on arch:all fontconfig-config going wrong 2021-04-10
#960866 src:libnewlib-nano libnewlib-nano FTBFS with meson 0.54.2-1 2021-08-16
#960867 fs-uae-launcher fs-uae-launcher: The application crash every time at the beginning 2021-04-20
#961147 src:libcolor-calc-perl libcolor-calc-perl: broken by new libgraphics-colornames-perl 2021-08-16
#961283 libhttp-tiny-perl libhttp-tiny-perl: Don't release with bullseye 2021-08-16
#961298 src:jodd jodd: CVE-2018-21234: Potential vulnerability in JSON deserialization 2021-05-20
#961622 gnome-twitch segfault on watching any stream 2021-07-24
#961834 clearlooks-phenix-theme clearlooks-phenix-theme: Theme look distorted possibly due to recent GTK3 upgrade 2021-08-16
#961969 src:mz mz is now part of netsniff-ng 2021-08-16
#962065 rdist rdist: Non-free license 2020-06-02
#962273 src:vault vault: FTBFS due to failing tests 2020-06-05
#962320 src:boost1.71 libboost-*1.71.0 packages need Breaks: libboost-*1.67.0 2020-06-23
#962323 python-django python-django: CVE-2020-13254 CVE-2020-13596 2020-06-28
#962629 rainloop rainloop: Rainloop stores passwords in cleartext in logfile 2020-07-09
#962650 src:libcamera libcamera: API and ABI appear to be changing without a SONAME bump 2021-10-20
#962938 src:lasagne lasagne: autopkgtest fails with newer python-mock 2020-07-28
#963072 src:haskell-easytest haskell-easytest: Does not build with hedgehog 1.x 2021-03-02
#963409 src:kakoune kakoune: FTBFS: dh_auto_test: error: make -j4 test returned exit code 2 2021-08-16
#963445 src:mediaconch mediaconch: FTBFS: dh: error: Unknown sequence configure-Project/GNU/CLI/ (choose from: binary binary-arch binary-indep build build-arch build-indep clean install install-arch install-indep) 2021-08-16
#963651 src:morse-simulator morse-simulator: FTBFS with Sphinx 3.1: Theme error: An error happened in rendering the page morse. 2021-03-02
#963737 src:highlighting-kate highlighting-kate: Removal notice: Deprecated 2021-08-16
#963748 src:haskell-gitlib haskell-gitlib: FTBFS with ghc-8.8 2021-08-16
#963777 src:condor condor: CVE-2019-18823 2020-06-26
#963998 src:gcc-9-cross-mipsen gcc-9-cross-mipsen: FTBFS: empty variable name 2020-06-30
#963999 src:gcc-python-plugin gcc-python-plugin: FTBFS: invalid literal for int() with base 10 2020-06-30
#964048 src:golang-github-tsenart-tb golang-github-tsenart-tb: FTBFS: TestThrottler_Wait failure 2021-08-16
#964055 src:hddemux hddemux: FTBFS: failed to query server 2021-08-16
#964138 src:sec src:sec: fails to migrate to testing for too long: maintainer built arch:all binary 2021-08-16
#964155 src:libtemplate-plugin-calendar-simple-perl libcalendar-simple-perl breaks libtemplate-plugin-calendar-simple-perl autopkgtest: not ok 1 - correct output for Jan 1970 2020-07-31
#964195 src:guacamole-server CVE-2020-9497 CVE-2020-9498 2021-02-03
#964329 xul-ext-exteditor xul-ext-exteditor <= 1.0.3-1 is not working or installable with Thunderbird 68 2020-07-05
#964335 linux-headers-amd64 linux-headers-amd64: cannot upgrade to 5.7.6-1 2020-07-05
#964404 src:quagga quagga is replaced by frr 2021-01-02
#964540 src:dropwatch dropwatch build times out in the testsuite 2021-08-16
#964548 src:vuls vuls: FTBFS: cannot find package "golang.org/x/oauth2" 2020-07-08
#964607 src:ruby-google-cloud-translate ruby-google-cloud-translate: FTBFS: unsatisfiable build-dependency: ruby-googleauth (< 0.10.0) but 0.13.0-2 is to be installed 2021-08-16
#964654 src:kcov kcov: FTBFS: ld: /usr/lib/gcc/x86_64-linux-gnu/9/../../../x86_64-linux-gnu/libbfd.a(plugin.o): undefined reference to symbol 'dlclose@@GLIBC_2.2.5' 2021-09-20
#964661 src:freebsd-glue freebsd-glue: FTBFS: dpkg-gensymbols: error: some symbols or patterns disappeared in the symbols file: see diff output below 2021-08-16
#964696 src:zyn zyn: FTBFS: pkg-config cannot find lv2core 2021-08-16
#964698 src:freebsd-libs freebsd-libs: FTBFS: dpkg-gensymbols: error: some symbols or patterns disappeared in the symbols file: see diff output below 2021-08-16
#964779 src:singularity-container singularity-container: FTBFS against golang-github-vbauerster-mpb-dev 5.0.3-2 (experimental) 2021-08-16
#964824 src:hdevtools hdevtools: FTBFS with GHC 8.8 2020-08-02
#964825 src:haskell-chell haskell-chell: BD-Uninstallable 2021-08-16
#964826 src:haskell-chell-quickcheck2 haskell-chell-quickcheck2: BD-Uninstallable 2021-08-16
#964830 src:haskell-icalendar haskell-icalendar: BD-Uninstallable 2021-08-16
#964842 src:haskell-yesod-auth-oauth2 haskell-yesod-auth-oauth2: BD-Uninstallable 2021-08-16
#964917 src:haskell-taskell haskell-taskell: BD-Uninstallable 2021-08-16
#964964 ruby-codemirror-rails ruby-codemirror-rails: ftbfs with rails 6 in experimental and unmainatained. 2020-11-03
#965006 libtomcat10-java, libtomcat10-embed-java libtomcat10{,-embed}-java: install files in 9.x paths 2020-07-16
#965026 grub-emu grub-emu is unusable with orca nor BRLTTY 2021-08-14
#965040 src:singularity-container singularity-container: CVE-2020-13845 CVE-2020-13846 CVE-2020-13847 2020-07-14
#965067 googler googler: "No results" 2020-08-18
#965075 postfixadmin postfixadmin: wrong alias in postfixadmin conf-available for apache2 2021-05-18
#965239 musescore-snapshot musescore-snapshot: FTBFS against Qt 5.14: error: ambiguous overload for ‘operator<<’ 2020-07-17
#965277 src:gnome-shell-xrdesktop gnome-shell-xrdesktop build depends on package in contrib 2020-07-18
#965311 src:uuagc uuagc: source missing 2020-07-19
#965985 src:bareos bareos: CVE-2020-4042 2020-08-24
#966014 src:crystal crystal build depends on library packages 2020-07-22
#966065 src:tome tome: FTBFS with GCC 10 due to insufficient #includes 2020-11-19
#966108 src:genesisplusgx genesisplusgx: FTBFS with GCC 10: multiple definition of ... due to -fno-common 2021-08-16
#966109 src:frobtads frobtads: FTBFS with GCC 10: error: missing '(' after "__has_builtin" 2020-07-25
#966112 src:fsl fsl: FTBFS with GCC 10: undefined reference to `int fslsurface_name::readGIFTI<float, unsigned int>(...) 2021-08-16
#966115 discodos discodos: /usr/bin/disco is already shipped by mono-devel 2021-09-21
#966250 src:python-peachpy python-peachpy binary-all FTBFS: dh_sphinxdoc: search.html does not load searchindex.js 2021-08-16
#966354 simtools simtools: FTBFS: install: cannot stat 'extracters/rstsflx/flx': No such file or directory 2020-07-27
#966446 src:node-solid-jose node-solid-jose: FTBFS Error: Cannot find module 'babel-helper-function-name' 2020-07-28
#966447 src:node-trust-jwa node-trust-jwa: FTBFS: Error: Cannot find module 'babel-helper-function-name' 2020-07-28
#966719 src:arriero arriero: Unversioned Python removal in sid/bullseye 2021-08-16
#966726 src:condor condor: Unversioned Python removal in sid/bullseye 2021-08-16
#966736 src:geda-gaf geda-gaf: Unversioned Python removal in sid/bullseye 2021-02-10
#966783 src:python-pmw python-pmw: Unversioned Python removal in sid/bullseye 2021-08-16
#966790 src:rivet rivet: Unversioned Python removal in sid/bullseye 2021-08-16
#966848 src:sarg sarg: FTBFS: util.c:589:29: error: ‘%03d’ directive output may be truncated writing between 3 and 11 bytes into a region of size 4 [-Werror=format-truncation=] 2021-08-16
#966862 src:gramophone2 gramophone2: FTBFS: ld: /tmp/ccWY0lhU.o:./global.h:70: multiple definition of `midi'; /tmp/ccHnI4GU.o:./global.h:70: first defined here 2021-08-16
#966877 src:termtris termtris: FTBFS: ld: src/game.o:/<<PKGBUILDDIR>>/src/game.h:21: multiple definition of `quit'; src/ansi.o:/<<PKGBUILDDIR>>/src/game.h:21: first defined here 2021-08-16
#966893 src:kvmtool kvmtool: FTBFS: string_fortified.h:34:10: error: writing 1 byte into a region of size 0 [-Werror=stringop-overflow=] 2021-08-16
#966926 src:dltlyse dltlyse: FTBFS: dh_auto_test: error: pybuild --test -i python{version} -p 3.8 returned exit code 13 2021-08-16
#966980 src:mochiweb mochiweb: FTBFS: beam/beam_load.c(1621): Error loading module rebar_utils: please re-compile this module with an 23 compiler (old-style fun with indices: 3/6) 2021-08-16
#966988 src:uftrace uftrace: FTBFS: test failed 2021-08-16
#967010 apache2 apache2: last debian 10.4 , last apache avail from repo hangs on install (and start phase) 2021-10-19
#967018 src:test-kitchen test-kitchen: FTBFS: ERROR: Test "ruby2.7" failed: cannot load such file -- aruba/in_process (LoadError) 2021-08-16
#967093 src:hothasktags hothasktags: FTBFS: unsatisfiable build-dependency: libghc-src-exts-dev (< 1.21) but 1.22.0-1 is to be installed 2020-10-29
#967102 src:rss2irc rss2irc: FTBFS: unsatisfiable build-dependencies: Depends: libghc-feed-dev (< 1.1) but 1.3.0.1-1 is to be installed 2021-08-16
#967144 src:gpaint gpaint: Unversioned Python removal in sid/bullseye 2021-08-16
#967166 src:lvtk lvtk: Unversioned Python removal in sid/bullseye 2021-08-16
#967182 src:nekobee nekobee: Unversioned Python removal in sid/bullseye 2021-08-16
#967187 src:openfst openfst: Unversioned Python removal in sid/bullseye 2021-08-16
#967193 src:pd-aubio pd-aubio: Unversioned Python removal in sid/bullseye 2021-08-16
#967195 src:patchage patchage: Unversioned Python removal in sid/bullseye 2021-08-16
#967207 src:raul raul: Unversioned Python removal in sid/bullseye 2021-08-16
#967228 src:uftrace uftrace: Unversioned Python removal in sid/bullseye 2021-08-16
#967229 src:viewmol viewmol: Unversioned Python removal in sid/bullseye 2021-08-16
#967236 src:zyn zyn: Unversioned Python removal in sid/bullseye 2021-08-16
#967623 src:marionnet marionnet: depends on deprecated GTK 2 2021-08-16
#967856 src:mod-gearman mod-gearman: keep out of testing 2021-08-16
#967915 gspiceui Depends on geda-gaf 2021-08-16
#967916 easyspice Depends on geda-gaf 2021-08-16
#967987 fuzz fuzz: Removal of sys_errlist 2021-10-13
#967990 mmorph mmorph: Removal of sys_nerr and sys_errlist 2021-10-13
#968019 src:enhanceio enhanceio: Unversioned Python removal in sid/bullseye 2020-08-06
#968022 src:sequitur-g2p sequitur-g2p: Unversioned Python removal in sid/bullseye 2020-08-06
#968024 src:netpbm-free netpbm-free: Unversioned Python removal in sid/bullseye 2021-03-05
#968186 python3-rgain3 python3-rgain3: API is potentially about to break 2020-08-10
#968312 src:eztrace-contrib eztrace-contrib: FTBFS with CUDA 11: cuda_runtime.cu(92): error: function "cudaMalloc(void **, size_t)" has already been defined 2021-03-05
#968381 bashtop bashtop: seems superceded by Python-based bpytop 2021-02-04
#968415 susv4 susv4: downloaded tarball no longer matches recorded checksum 2021-08-07
#968957 src:bareos bareos: CVE-2020-11061 2020-08-24
#969157 ruby-diaspora-federation-rails ruby-diaspora-federation-rails: FTBFS with rails 6 - Could not find 'actionpack' (< 6, >= 4.2) - did find: [actionpack-6.0.3.1] 2020-08-28
#969206 redmine redmine: Could not find gem 'rails (~> 5.2.2)' in any of the gem sources listed in your Gemfile 2021-08-30
#969609 src:rust-zstd rust-zstd: unbuildable, uninstallable, depends on non-existent rust-zstd-safe 2021-03-10
#969885 megadown megadown: [python] is required and it's not installed 2021-08-16
#969907 libpoppler-glib8 inkscape, etc. crashing with mismatched libpoppler102 and libpoppler-glib8 2021-08-14
#969938 debirf debirf: bullseye: switch from /updates to -security 2021-08-16
#970104 src:rust-gstreamer rust-gstreamer has unsatisfiable dependency on non-existent rust-futures-core-preview 2021-03-01
#970109 librust-derive-builder+compiletest-rs-dev rust-derive-builder has unsatisfiable dependency on non-existent rust-compiletest-rs 2021-03-01
#970186 src:rust-rand-core-0.3 rust-rand-core-0.3: Unaligned memory access resulting in undefined behavior 2021-01-09
#970406 src:flowcanvas flowcanvas build-depends unsatisfiable in testing and unstable. 2021-08-16
#970417 bind-host bind-host: missing 'host' binary 2020-09-15
#970419 lilyterm lilyterm: No longer starts (likely related to VTE changes) 2021-08-16
#970453 src:coq-float coq-float: FTBFS in sid 2021-03-02
#970454 src:aac-tactics aac-tactics: FTBFS in sid 2021-03-07
#970465 src:singularity-container singularity-container: CVE-2020-25039 CVE-2020-25040 2020-09-16
#970870 postgresql-autodoc postgresql-autodoc: incompatible with PostgreSQL >= 12 2021-08-16
#970915 src:isakmpd isakmpd: outdated upstream source unacceptable for distribution 2020-09-25
#970916 src:vzctl vzctl: unusable without kernel support 2020-09-25
#970917 src:vzquota vzquota: unusable without kernel support 2020-09-25
#971136 src:sqsh sqsh: FTBFS: cmd_connect.c:1906:17: error: ‘CS_MAX_CHAR’ undeclared (first use in this function); did you mean ‘CS_VARCHAR’? 2021-08-16
#971176 src:ocaml-reins ocaml-reins: FTBFS: File config.omake: line 9, characters 10-29 unbound variable: this.OCAMLDEP_MODULES 2021-08-16
#971184 src:drmips drmips: FTBFS: make[3]: *** No rule to make target 'src/pc/DrMIPS/lib/DrMIPSSimulator.jar', needed by 'src/pc/DrMIPS/src/CMakeFiles/DrMIPS.dir/java_compiled_DrMIPS'. Stop. 2021-08-16
#971207 src:rust-inotify-sys rust-inotify-sys: FTBFS: dh_auto_test: error: /usr/share/cargo/bin/cargo test --all returned exit code 1 2021-08-16
#971223 src:rust-redox-termios rust-redox-termios: FTBFS: dh_auto_test: error: /usr/share/cargo/bin/cargo build returned exit code 101 2021-08-16
#971255 kopanocore kopanocore: autopkgtest fails on assuming /etc/init.d/mysql exists 2021-02-17
#971325 src:renpy renpy: uses deprecated libavresample 2021-09-29
#971636 php-lua undefined symbol: ZEND_HASH_GET_APPLY_COUNT 2020-10-25
#971774 tinyjsd Doesn't support Thunderbird 68 / 78 2020-10-06
#971832 src:haskell-hoogle haskell-hoogle: autopkgtest regression on armhf: The Hoogle file /var/lib/hoogle/databases/default.hoo is truncated, probably due to an error during creation. 2021-05-01
#972011 src:meliae meliae's autopkg tests fail, and package ftbfs with python3.9 2021-02-28
#972084 gweled gweled: Display is glitching 2021-08-16
#972100 src:rust-ncurses CVE-2019-15547 CVE-2019-15548 2020-10-14
#972128 kannel-sqlbox kannel-sqlbox: Please remove support for long-unmaintained sqlite 2 2021-08-16
#972146 mono-runtime-common /usr/share/applications/mono-runtime-common.desktop: should not handle MIME type by executing arbitrary code 2021-08-17
#972211 src:mldonkey FTBFS with OCaml 4.11.1 (-unsafe-string is not available) 2020-10-14
#972212 src:singularity-container singularity-container: CVE-2020-15229 2020-10-14
#972230 jruby CVE-2017-17742 CVE-2019-16201 CVE-2019-16254 CVE-2019-16255 CVE-2020-25613 2021-04-19
#972259 src:galax FTBFS with OCaml 4.11.1 (-unsafe-string is not available) 2021-02-28
#972261 src:ocaml-melt FTBFS with OCaml 4.11.1 (-unsafe-string is not available) 2021-03-01
#972363 src:etesync-dav etesync-dav: unsatisfiable build dependencies: python3-radicale (<< 2.1.12) 2021-03-02
#972663 src:jsunit jsunit needs updating in stable 2020-10-22
#972714 src:rocr-runtime rocr-runtime: missing B-D: cmake 2020-10-22
#972829 rust-lldb rust-lldb: depends on nonexistent package python3-lldb-7 in buster 2021-03-24
#972910 src:lasagne lasagne ftbfs with python3.9 2021-01-02
#972915 src:pluginhook pluginhook FTBFS on mipsel/mips64el: -buildmode=pie not supported 2021-07-25
#972992 j4-dmenu-desktop j4-dmenu-desktop: dmenu and i3-sensible-terminal missing 2020-10-27
#973059 src:logging-tree logging-tree: FTBFS: dh_auto_test: error: pybuild --test -i python{version} -p "3.9 3.8" returned exit code 13 2021-08-16
#973060 src:bumpversion bumpversion: FTBFS: dh_auto_test: error: pybuild --test --test-pytest -i python{version} -p "3.9 3.8" returned exit code 13 2021-08-16
#973086 src:celery-haystack celery-haystack: FTBFS: dh_auto_test: error: pybuild --test -i python{version} -p "3.9 3.8" returned exit code 13 2021-08-16
#973124 src:unison-2.48 unison-2.48: FTBFS: ocamlc: OCaml has been configured with -force-safe-string: -unsafe-string is not available. 2021-08-16
#973128 src:celery-batches celery-batches: FTBFS: dh_auto_test: error: pybuild --test -i python{version} -p "3.9 3.8" returned exit code 13 2021-08-16
#973153 src:caml-crush caml-crush: FTBFS: ocamlopt: OCaml has been configured with -force-safe-string: -unsafe-string is not available. 2021-08-20
#973172 src:zaqar zaqar: FTBFS: TypeError: __init__() got an unexpected keyword argument 'encoding' 2021-08-16
#973181 src:camljava camljava: FTBFS: Please specify at most one of -pack, -a, -c, -output-obj 2021-08-16
#973183 src:doublex doublex: FTBFS: dh_auto_test: error: pybuild --test --test-nose -i python{version} -p "3.9 3.8" returned exit code 13 2021-08-16
#973192 src:python-gear python-gear: FTBFS: make[1]: pyversions: No such file or directory 2021-08-16
#973233 src:tinc tinc: FTBFS: configure: error: VDE plug header files not found. 2021-08-16
#973599 src:nvidia-graphics-drivers-legacy-340xx nvidia-graphics-drivers-legacy-340xx: EoL driver should not be released with bullseye 2021-07-26
#973641 src:isc-kea isc-kea: FTBFS in current pbuilder environment 2020-11-02
#973778 src:rust-nitrokey-sys rust-nitrokey-sys: unsatifiable B-D: librust-bindgen-0.51+default-dev 2021-03-07
#973816 src:qemu-sbuild-utils qemu-sbuild-utils 2020-11-05
#973850 lilo lilo: Should not be included in bullseye 2021-09-13
#973927 incron incron SEGV when monitoring directories 2021-03-07
#974014 diaspora Fails to install due to depending on ruby-rails < 6.0 2021-03-02
#974083 src:jsunit autopkgtest fails with thunderbird 78 2020-11-09
#974116 src:rust-trust-dns-proto rust-trust-dns-proto: FTBFS build-depends on librust-smallvec-0.6+default-dev 2021-03-01
#974117 src:rust-image rust-image: FTBFS build-depends on librust-tiff-0.3+default-dev 2020-11-10
#974118 src:rust-pbkdf2 rust-pbkdf2: FTBFS build-depends on librust-base64-0.10+default-dev 2021-03-02
#974197 src:rust-hdrhistogram rust-hdrhistogram: unsatisfiable build-dependency 2021-03-02
#974586 loganalyzer loganalyzer: depends on php5 to use mysql db as a backend. 2021-02-02
#974604 src:rust-sloppy-rfc4880 rust-sloppy-rfc4880: unsatisfiable build-dependency 2021-03-02
#974606 src:rust-tokio-process rust-tokio-process: unsatisfiable build-dependency 2021-03-02
#974616 nomacs nomacs uses internal libexiv2 functions to get the user comment 2021-04-04
#974778 src:llvmlite llvmlite: Please upgrade to llvm-toolchain-11 2021-09-22
#974792 beignet beignet: Please upgrade to llvm-toolchain-11 2021-09-30
#974793 oclgrind oclgrind: Please upgrade to llvm-toolchain-11 2021-09-22
#975120 spdx-licenses spdx-licenses: upstream source is not true source 2020-11-19
#975138 src:simulavr simulavr: FTBFS: collect2: error: ld returned 1 exit status 2021-08-16
#975191 src:rust-js-sys rust-js-sys: FTBFS: dh_auto_test: error: /usr/share/cargo/bin/cargo build returned exit code 101 2021-09-07
#975238 src:python-cement python-cement: FTBFS: E: Build killed with signal TERM after 150 minutes of inactivity 2021-08-16
#975464 src:haskell-werewolf haskell-werewolf: Removal notice: broken and unmaintained 2021-08-16
#975490 u-boot-sunxi u-boot-sunxi: A64-Olinuxino-eMMC boot stuck at "Starting kernel ..." 2021-08-14
#975501 dpaste FTBFS: undefined reference to symbol 'SSL_get_verify_callback@@OPENSSL_1_1_0' 2020-11-23
#975535 src:elpy elpy's autopkg tests fail with Python 3.9 2021-02-18
#975659 src:libaio-ocaml libaio-ocaml: FTBFS with ocaml 4.11 2021-03-07
#975708 installation-reports installation-reports: Many disk start/stop with daily-image installer on LS-XHL 2020-11-25
#975739 src:rust-aes-soft rust-aes-soft: FTBFS: build-dependency not installable: librust-opaque-debug-0.2+default-dev 2021-08-16
#975802 src:gitano gitano: FTBFS: dh_auto_test: error: make -j1 test returned exit code 2 2021-08-16
#975810 src:fonts-pecita fonts-pecita: FTBFS: Error: Validation error 2021-08-16
#975926 enigmail enigmail should not be shipped in bookworm 2021-05-15
#975931 libllvm11 libllvm11: libgpuarray autopkgtest using pocl on armhf triggers segfault 2021-10-05
#976078 libretro-mupen64plus FTBFS: multiple definitions 2021-08-16
#976156 libapache-mod-auth-kerb libapache-mod-auth-kerb probably shouldn't be released in its current form 2021-08-16
#976351 node-request-promise-core node-request: deprecated upstream: should not be part of next stable Debian release 2020-12-03
#976372 gnome-shell-xrdesktop gnome-shell-xrdesktop: FTBFS and is not built against latest libmutter 2020-12-04
#976467 src:rust-core-arch rust-core-arch FTBFS error[E0635]: unknown feature `mmx_target_feature` 2021-08-16
#976477 src:jruby jruby: FTBFS: cp: cannot stat '/usr/lib/ruby/vendor_ruby/rake*': No such file or directory 2021-08-16
#976493 src:ruby-psych ruby-psych: FTBFS: NameError: undefined method `default_specifications_dir' for class `#<Class:0x1cfd1875>' 2021-08-16
#976499 src:dune-pdelab dune-pdelab: FTBFS: segfaults during tests 2021-08-16
#976530 src:dolphin-emu dolphin-emu: FTBFS: tests failed 2021-10-11
#976540 src:clippoly clippoly: FTBFS on arm64,ppc64el: dh_auto_test: error: make -j4 check VERBOSE=1 returned exit code 2 2021-08-16
#976697 webext-umatrix webext-umatrix: no longer developed upstream, remove or switch to LibreMatrix or? 2021-09-05
#976730 src:firefox firefox: FTBFS on armhf (unresolved imports `core::arch::arm::float32x4_t`, `core::arch::arm::int32x4_t`, `core::arch::arm::vaddq_f32`) 2021-08-19
#976794 php-doctrine-reflection Useless in Debian 2020-12-08
#976820 src:gitaly gitaly: use golang-gopkg-libgit2-git2go.v30 2021-04-08
#977056 src:beanbag beanbag FTBFS with pytest 6 2021-01-24
#977079 src:pytest-bdd pytest-bdd FTBFS with pytest 6 2021-01-17
#977192 src:libappimage libappimage: CVE-2020-25265 2020-12-29
#977279 src:ploop ploop FTBFS on armhf, i386: error: ‘%s’ directive output may be truncated writing between 2 and 2147483645 bytes into a region of size 4083 2020-12-13
#977707 bareos-database-common Install fails with mysql error 1005 2020-12-19
#977708 bareos on purge not all files are removed 2020-12-19
#977765 src:gsfonts src:gsfonts: package superseded by fonts-urw-base35 2021-08-16
#977801 php-finder-facade Useless in Bullseye 2020-12-24
#977802 php-token-stream Useless in Bullseye 2020-12-24
#977805 src:ntopng ntopng: FTBFS in sid 2021-08-16
#977979 jruby jruby fails to run without declaring the DEBIAN_DISABLE_RUBYGEMS_INTEGRATION environment variable 2021-01-01
#978000 src:boost1.71 boost1.71: should not be part of bullseye 2020-12-24
#978026 kvpm kvpm: crash after launch 2020-12-24
#978079 python3-rawkit python3-rawkit: Support for libraw20 missing 2021-01-25
#978228 src:vagrant-librarian-puppet vagrant-librarian-puppet: FTBFS: ruby-faraday : Breaks: ruby-puppet-forge (<= 2.3.2-1) but 2.3.2-1 is to be installed 2021-08-16
#978237 src:xfce4-equake-plugin xfce4-equake-plugin: FTBFS: build-dependency not installable: xfce4-panel (= 4.14.4-1) 2021-08-16
#978257 src:pynwb pynwb: FTBFS: dh_auto_test: error: pybuild --test -i python{version} -p 3.9 returned exit code 13 2021-02-15
#978259 src:python-testing.mysqld python-testing.mysqld: FTBFS: dh_auto_test: error: pybuild --test --test-nose -i python{version} -p 3.9 returned exit code 13 2021-08-16
#978287 src:py-lz4framed py-lz4framed: FTBFS: dpkg-buildpackage: error: dpkg-source -b . subprocess returned exit status 2 2021-08-16
#978322 src:rust-sleef-sys rust-sleef-sys: FTBFS: dh_auto_test: error: /usr/share/cargo/bin/cargo test --all returned exit code 101 2021-08-16
#978344 src:spellutils spellutils: FTBFS: configure:4772: error: possibly undefined macro: AM_INTL_SUBDIR (caused by gettext 0.19 -> 0.21?) 2021-08-16
#978441 src:singularity-container singularity-container: FTBFS: cannot find package "github.com/kr/pty" 2020-12-27
#978511 gcc-python-plugin gcc-python-plugin: non-standard gcc/g++ used for build (gcc-9) 2021-08-16
#978513 kfreebsd-10 kfreebsd-10: non-standard gcc/g++ used for build (gcc-9) 2021-08-16
#978782 src:charybdis charybdis: ftbfs with autoconf 2.70 2021-08-24
#978830 src:gtkhash gtkhash: ftbfs with autoconf 2.70 2021-09-30
#978836 src:heimdal heimdal: ftbfs with autoconf 2.70 2021-08-24
#978867 src:mpich mpich: ftbfs with autoconf 2.70 2021-08-24
#978869 src:nemiver nemiver: ftbfs with autoconf 2.70 2021-08-24
#978875 src:ocaml ocaml: ftbfs with autoconf 2.70 2021-08-24
#978881 src:pidgin pidgin: ftbfs with autoconf 2.70 2021-08-24
#978882 src:pike8.0 pike8.0: ftbfs with autoconf 2.70 2021-09-08
#978893 src:ripperx ripperx: ftbfs with autoconf 2.70 2021-09-20
#978900 src:ruby2.7 ruby2.7: ftbfs with autoconf 2.70 2021-08-24
#978911 src:transmission transmission: ftbfs with autoconf 2.70 2021-10-21
#978926 src:xscreensaver xscreensaver: ftbfs with autoconf 2.70 2021-08-24
#979095 multipath-tools Legally problematic GPL-3+ readline dependency 2021-10-14
#979101 devtodo Legally problematic GPL-3+ readline dependency 2021-10-18
#979102 maxima Legally problematic GPL-3+ readline dependency 2021-10-13
#979146 src:gnat-gps gnat-gps: FTBFS because BD can not be installed (gnat-9 vs 10) 2021-08-16
#979257 rabbitvcs-gedit rabbitvcs-gedit plugin does not load on gedit 3.8+ 2021-02-02
#979304 src:libsnmp-multi-perl src:libsnmp-multi-perl: invalid maintainer addres 2021-08-16
#979388 src:kopete kopete: FTBFS: error: template with C linkage 2021-01-06
#979427 src:libnet-ipaddress-perl src:libnet-ipaddress-perl: invalid maintainer address 2021-08-16
#979462 aplus-fsf aplus-fsf: FTBFS against glibc 2.32 2021-10-11
#979504 src:libtext-string-hexconvert-perl src:libtext-string-hexconvert-perl: invalid maintainer address 2021-08-16
#979545 courier-mlm the stretch-pu: package courier/0.76.3-5+deb9u1 still are broken 2021-01-08
#979563 gitlab rugged/libgit2 1.x breaks gitlab 2021-04-08
#979614 seamly2d seamly2d: virtually dead fork of valentina 2021-06-03
#979625 src:python-cooler autopkgtest: ModuleNotFoundError (ipytree) and AssertionError 2021-03-16
#979655 src:llvm-toolchain-6.0 llvm-toolchain-6.0: Test suite hangs the autobuilder on single-CPU systems 2021-01-09
#979656 src:llvm-toolchain-7 llvm-toolchain-7: Test suite hangs the autobuilder on single-CPU systems 2021-01-09
#979671 src:nvidia-graphics-drivers-legacy-340xx nvidia-graphics-drivers-legacy-340xx: CVE-2021-1056 2021-01-19
#979719 socat socat in experimental is obsolete and no installable 2021-01-12
#979747 rtpproxy rtpproxy: FTBFS with GCC 10 2021-08-16
#980023 src:petri-foo petri-foo: FTBFS with GCC 10 2021-08-16
#980071 gnome-shell gnome-shell: Using suspend in the gnome-shell power off/log out menu does log out and suspend in the wrong order 2021-08-14
#980267 src:qdjango qdjango: FTBFS on buildds 2021-08-16
#980338 src:hotswap hotswap: should ship with bullseye? 2021-02-01
#980348 src:ruby-wirble ruby-wirble: ship with bullseye? 2021-02-01
#980575 src:kworkflow kworkflow: autopkgtest needs update for new version of git 2021-08-16
#980612 src:sbt-launcher-interface sbt-launcher-interface: FTBFS: launcher-implementation/src/main/scala/xsbt/boot/Update.scala:190: error: type mismatch; 2021-08-16
#980627 src:ruby-dataobjects-mysql ruby-dataobjects-mysql: FTBFS: E: Build killed with signal TERM after 150 minutes of inactivity 2021-10-12
#980707 src:octave-symbolic octave-symbolic: FTBFS against sympy 1.7 2021-02-13
#980951 src:erlang-ranch erlang-ranch: FTBFS: ssl:cipher_suites/0 is deprecated 2021-01-24
#980957 src:llvm-toolchain-11 llvm-toolchain-11 autopkgtest segfaults on armhf 2021-10-14
#981009 charybdis charybdis abandoned upstream, do not ship in bullseye 2021-02-18
#981054 openipmi openipmi: Missing dependency on kmod 2021-08-14
#981088 libpe-status10 pacemaker: crm shell can't be executed due to a library error 2021-03-26
#981224 src:ruby-uglifier ruby-uglifier: FTBFS: tests fail: uglifier_spec.rb:383, uglifier_spec.rb:751 2021-07-07
#981229 src:dub dub: autopkgtest regression 2021-10-07
#981233 php-webimpress-safe-writer Useless in Bullseye 2021-01-28
#981484 webext-exteditor webext-exteditor: not compatible with current thunderbird 2021-03-15
#981496 svtools svtools: ship with bullseye? 2021-09-08
#981522 src:varmon varmon - ship with bullseye? 2021-08-22
#981523 fusesmb fusesmb: ship with bullseye? 2021-08-20
#981536 google-cloud-print-connector google-cloud-print-connector: Service has been shutdown 2021-02-01
#981670 libmsdw-smtp-perl libmsdw-smtp-perl needs Breaks+Replaces: dkimproxy 2021-02-02
#981680 src:golang-github-canonical-go-dqlite golang-github-canonical-go-dqlite FTBFS: test failures 2021-02-02
#981713 src:graftcp graftcp: Not ready for stable release 2021-02-03
#981761 netopeer2 netopeer2 installs world-writable files 2021-10-18
#981762 chibi-scheme-images chibi-scheme-images fails to install: chibi-scheme: not found 2021-02-03
#981774 src:fastnetmon fastnetmon FTBFS with ndpi 3.4 2021-02-03
#981822 librust-bytemuck-dev librust-bytemuck-dev: Depends: librust-bytemuck-derive-1+default-dev but it is not installable 2021-02-04
#981831 src:dbcsr dbcsr FTBFS: dbcsr_perf:inputs/test_square_sparse_rma.perf (Failed) 2021-02-04
#981869 librust-tcmalloc-dev librust-tcmalloc-dev: Depends: librust-tcmalloc-sys-0.3+default-dev but it is not installable 2021-02-04
#981878 src:ruby-gitlab-pg-query ruby-gitlab-pg-query downloads from the internet during the build 2021-03-06
#981886 src:intellij-community-idea intellij-community-idea build depends on openjdk-8-jdk-headless that will not be in bullseye 2021-02-05
#981903 src:puppetdb puppetdb: autopkgtest failure 2021-02-04
#981925 src:tiledb tiledb FTBFS: test failures 2021-02-05
#981928 src:gauche-gtk gauche-gtk FTBFS: unknown define-cclass qualifier(s) (::base) 2021-08-16
#982034 src:forked-daapd forked-daapd: autopkgtest regression in testing: Job for forked-daapd.service failed. 2021-02-05
#982095 src:haskell-yesod-bin haskell-yesod-bin: autopkgtest failure 2021-02-06
#982100 src:faiss faiss: autopkgtest failure on arm64 2021-02-06
#982113 src:srslte srslte: AVX2 versions are missing 2021-02-06
#982123 src:librsvg librsvg: FTBFS on ppc64el in buster 2021-08-16
#982159 dxvk dxvk: Dependency on development version of WINE might not be justified 2021-07-22
#982177 src:php8.0 php8.0: should not be released with bullseye? 2021-09-02
#982210 src:flask-limiter flask-limiter: autopkgtest failure 2021-02-07
#982316 yubikey-ksm Errors in config file from package yubikey-ksm (apache.conf) 2021-02-08
#982381 s3ql AttributeError: lowlevel due to trio usage in s3ql/block_cache.py 2021-06-04
#982459 mdadm mdadm --examine in chroot without /proc,/dev,/sys mounted corrupts host's filesystem 2021-08-28
#982522 ruby-activeldap ruby-activeldap: should depend on ruby-builder 2021-05-31
#982632 nomad-driver-podman 0.1.0 release is outdated and incompatible with podman 3.0 2021-02-12
#982647 src:spyder-reports spyder-reports: incompatible with spyder 4.2.1+ 2021-02-14
#982685 sl-modem sl-modem: Depends on removed package execstack 2021-08-16
#982703 src:gcc-m68hc1x gcc-m68hc1x: FTBFS: ../../src/gcc/config/m68hc11/larith.asm:108: Error: attempt to store non-zero value in section `.softregs' 2021-08-16
#982712 src:tiledarray tiledarray: FTBFS: gemm_helper.h:168:30: error: expected initializer before ‘const’ 2021-08-16
#982766 src:node-webpack node-webpack: remove dependency on node-uglifyjs-webpack-plugin 2021-04-10
#982794 firefox-esr firefox-esr/armhf: fails on non-NEON systems 2021-08-14
#982807 datovka datovka: version too old to be useful 2021-08-16
#982830 src:golang-code.gitea-git golang-code.gitea-git: unmaintained go library - keep out of testing 2021-02-15
#982838 src:win32-loader RoM: win32-loader must not migrate automatically 2021-02-19
#982864 src:perceptualdiff perceptualdiff FTBFS with test failure on several architectures 2021-09-22
#983010 src:debiman mdocml breaks debiman autopkgtest: different output 2021-02-26
#983206 libupnp13 [libupnp13] Please update for CVE-2020-12695 & fixes 2021-09-28
#983224 src:sosi2osm sosi2osm: FTBFS with PROJ 8.0.0 2021-10-22
#983229 src:survex survex: FTBFS with PROJ 8.0.0 2021-10-22
#983230 src:xygrib xygrib: FTBFS with PROJ 8.0.0 2021-10-22
#983253 src:ncl ncl: FTBFS with PROJ 8.0.0 2021-10-22
#983254 src:openorienteering-mapper openorienteering-mapper: FTBFS with PROJ 8.0.0 2021-10-22
#983365 src:linphone linphone-desktop: chat messages 2021-08-16
#983615 enhanceio-dkms enhanceio-dkms: module FTBFS for Linux 5.10: unknown type name 'make_request_fn' 2021-02-28
#983617 gitaly gitaly: fails to install: Could not find gem 'grpc (~> 1.30, >= 1.30.2)' 2021-03-09
#983618 python3-django python3-django 3.2 breaks python3-django-pyscss 2021-05-30
#983619 vdr-markad vdr-markad: fails to install: chown: invalid user: 'vdr:vdr' 2021-02-27
#983648 kpatch-dkms kpatch-dkms: fails to build module for Linux 5.10: uses unknown struct stack_trace 2021-08-16
#983650 sl-modem-dkms sl-modem-dkms: fails to build module for Linux 5.10 2021-02-28
#983770 rnp rnp: FTBFS on 32-bit platforms (test suite failures) 2021-04-24
#983784 obs-api obs-api: fails to install: Could not find gem 'data_migrate (= 5.3.1)' 2021-03-01
#983874 gitaly gitaly: fails to install: Could not find gem 'rugged (~> 0.28)' 2021-05-11
#983913 puppet-master, puppet-master-passenger puppet-master,puppet-master-passenger: depends on unavailable puppet-server 2021-03-03
#983915 gitlab gitlab: fails to install: Could not find gem 'rugged (~> 0.28)' 2021-04-25
#983920 dgit-test-dummy dgit-test-dummy: intentionally uninstallable package 2021-03-03
#983924 gitlab GitLab 13.7.7: ERROR in <ttf-font-file> 1:0 Module parse failed: Unexpected character '' (1:0) 2021-03-04
#983959 src:actor-framework actor-framework: ftbfs with GCC-11 2021-10-10
#983961 src:advancecomp advancecomp: ftbfs with GCC-11 2021-10-10
#983963 src:aiksaurus aiksaurus: ftbfs with GCC-11 2021-10-10
#983964 src:android-platform-art android-platform-art: ftbfs with GCC-11 2021-10-10
#983966 src:android-platform-system-core android-platform-system-core: ftbfs with GCC-11 2021-10-10
#983967 src:aoflagger aoflagger: ftbfs with GCC-11 2021-10-10
#983968 src:android-platform-system-tools-aidl android-platform-system-tools-aidl: ftbfs with GCC-11 2021-10-10
#983969 src:armnn armnn: ftbfs with GCC-11 2021-10-10
#983970 src:aplus-fsf aplus-fsf: ftbfs with GCC-11 2021-10-13
#983972 src:aqsis aqsis: ftbfs with GCC-11 2021-10-10
#983973 src:asmjit asmjit: ftbfs with GCC-11 2021-10-10
#983979 src:bagel bagel: ftbfs with GCC-11 2021-10-10
#983981 src:bamtools bamtools: ftbfs with GCC-11 2021-10-18
#983982 src:bazel-bootstrap bazel-bootstrap: ftbfs with GCC-11 2021-10-10
#983985 src:bctoolbox bctoolbox: ftbfs with GCC-11 2021-10-10
#983990 src:bino bino: ftbfs with GCC-11 2021-10-10
#983991 src:bist bist: ftbfs with GCC-11 2021-10-10
#983993 src:binutils-avr binutils-avr: ftbfs with GCC-11 2021-10-10
#983996 src:blist blist: ftbfs with GCC-11 2021-10-11
#983999 src:bonnie++ bonnie++: ftbfs with GCC-11 2021-10-10
#984002 src:boxbackup boxbackup: ftbfs with GCC-11 2021-10-10
#984005 src:cava-alsa cava-alsa: ftbfs with GCC-11 2021-10-10
#984006 src:caja-eiciel caja-eiciel: ftbfs with GCC-11 2021-10-10
#984008 src:cbmc cbmc: ftbfs with GCC-11 2021-10-10
#984010 src:chkservice chkservice: ftbfs with GCC-11 2021-10-10
#984012 src:chuck chuck: ftbfs with GCC-11 2021-10-10
#984013 src:chromium chromium: ftbfs with GCC-11 2021-10-10
#984014 src:clementine clementine: ftbfs with GCC-11 2021-10-10
#984015 src:cif-tools cif-tools: ftbfs with GCC-11 2021-10-10
#984019 src:cmtk cmtk: ftbfs with GCC-11 2021-10-10
#984020 src:codeblocks codeblocks: ftbfs with GCC-11 2021-10-10
#984025 src:criterion criterion: ftbfs with GCC-11 2021-10-10
#984027 src:darkice darkice: ftbfs with GCC-11 2021-10-11
#984030 src:d-itg d-itg: ftbfs with GCC-11 2021-10-10
#984031 src:diagnostics diagnostics: ftbfs with GCC-11 2021-10-10
#984036 src:disulfinder disulfinder: ftbfs with GCC-11 2021-10-10
#984037 src:doscan doscan: ftbfs with GCC-11 2021-10-10
#984038 src:drawtiming drawtiming: ftbfs with GCC-11 2021-10-10
#984039 src:drawxtl drawxtl: ftbfs with GCC-11 2021-10-10
#984040 src:drumgizmo drumgizmo: ftbfs with GCC-11 2021-10-10
#984042 src:libcifpp dssp: ftbfs with GCC-11 2021-10-11
#984044 src:dx dx: ftbfs with GCC-11 2021-10-10
#984047 src:elastix elastix: ftbfs with GCC-11 2021-10-10
#984048 src:effcee effcee: ftbfs with GCC-11 2021-10-10
#984049 src:enblend-enfuse enblend-enfuse: ftbfs with GCC-11 2021-10-10
#984050 src:endless-sky endless-sky: ftbfs with GCC-11 2021-10-10
#984053 src:etl etl: ftbfs with GCC-11 2021-10-11
#984055 src:fastqtl fastqtl: ftbfs with GCC-11 2021-10-10
#984056 src:ifhp ifhp: ftbfs with GCC-11 2021-10-10
#984057 src:infinipath-psm infinipath-psm: ftbfs with GCC-11 2021-10-10
#984059 src:imview imview: ftbfs with GCC-11 2021-10-10
#984061 src:intel-graphics-compiler intel-graphics-compiler: ftbfs with GCC-11 2021-10-10
#984063 src:insighttoolkit4 insighttoolkit4: ftbfs with GCC-11 2021-10-10
#984068 src:itksnap itksnap: ftbfs with GCC-11 2021-10-10
#984070 src:jaula jaula: ftbfs with GCC-11 2021-10-10
#984071 src:jigdo jigdo: ftbfs with GCC-11 2021-10-10
#984080 src:lamarc lamarc: ftbfs with GCC-11 2021-10-20
#984081 src:lastz lastz: ftbfs with GCC-11 2021-10-10
#984082 src:leatherman leatherman: ftbfs with GCC-11 2021-10-11
#984083 src:lasi lasi: ftbfs with GCC-11 2021-10-15
#984087 src:libayatana-appindicator libayatana-appindicator: ftbfs with GCC-11 2021-10-10
#984090 src:libbpp-raa libbpp-raa: ftbfs with GCC-11 2021-10-10
#984096 src:libcommoncpp2 libcommoncpp2: ftbfs with GCC-11 2021-10-10
#984100 src:libdjconsole libdjconsole: ftbfs with GCC-11 2021-10-10
#984102 src:libfm-qt libfm-qt: ftbfs with GCC-11 2021-10-10
#984111 src:libgrokj2k libgrokj2k: ftbfs with GCC-11 2021-10-10
#984112 src:libimage-seek-perl libimage-seek-perl: ftbfs with GCC-11 2021-10-10
#984114 src:liblastfm liblastfm: ftbfs with GCC-11 2021-10-10
#984118 src:farmhash farmhash: ftbfs with GCC-11 2021-10-10
#984119 src:fbpager fbpager: ftbfs with GCC-11 2021-10-10
#984120 src:fcoe-utils fcoe-utils: ftbfs with GCC-11 2021-10-10
#984121 src:fbreader fbreader: ftbfs with GCC-11 2021-10-10
#984122 src:fceux fceux: ftbfs with GCC-11 2021-10-10
#984123 src:fityk fityk: ftbfs with GCC-11 2021-10-18
#984131 src:flmsg flmsg: ftbfs with GCC-11 2021-10-10
#984134 src:fluxbox fluxbox: ftbfs with GCC-11 2021-10-10
#984144 src:fwbuilder fwbuilder: ftbfs with GCC-11 2021-10-10
#984148 src:gcc-avr gcc-avr: ftbfs with GCC-11 2021-10-10
#984149 src:genparse genparse: ftbfs with GCC-11 2021-10-10
#984152 src:giac giac: ftbfs with GCC-11 2021-10-10
#984153 src:gle-graphics gle-graphics: ftbfs with GCC-11 2021-10-10
#984154 src:gnome-chemistry-utils gnome-chemistry-utils: ftbfs with GCC-11 2021-10-10
#984155 src:goxel goxel: ftbfs with GCC-11 2021-10-10
#984158 src:grfcodec grfcodec: ftbfs with GCC-11 2021-10-10
#984159 src:gnubiff gnubiff: ftbfs with GCC-11 2021-10-10
#984163 src:guessnet guessnet: ftbfs with GCC-11 2021-10-10
#984166 src:hashdeep hashdeep: ftbfs with GCC-11 2021-10-10
#984167 src:haskell-alsa-mixer haskell-alsa-mixer: ftbfs with GCC-11 2021-10-10
#984168 src:haskell-bz2 haskell-bz2: ftbfs with GCC-11 2021-10-10
#984169 src:haskell-gi-cairo-render haskell-gi-cairo-render: ftbfs with GCC-11 2021-10-10
#984170 src:haskell-cairo haskell-cairo: ftbfs with GCC-11 2021-10-10
#984171 src:haskell-gtk haskell-gtk: ftbfs with GCC-11 2021-10-10
#984172 src:haskell-gio haskell-gio: ftbfs with GCC-11 2021-10-10
#984173 src:haskell-gtk3 haskell-gtk3: ftbfs with GCC-11 2021-10-10
#984174 src:haskell-glib haskell-glib: ftbfs with GCC-11 2021-10-10
#984175 src:highwayhash highwayhash: ftbfs with GCC-11 2021-10-10
#984176 src:haskell-pango haskell-pango: ftbfs with GCC-11 2021-10-10
#984180 src:htdig htdig: ftbfs with GCC-11 2021-10-10
#984184 src:libmediainfo libmediainfo: ftbfs with GCC-11 2021-10-10
#984187 src:libneo4j-client libneo4j-client: ftbfs with GCC-11 2021-10-10
#984189 src:libodb libodb-boost: ftbfs with GCC-11 2021-10-11
#984190 src:libnop libnop: ftbfs with GCC-11 2021-10-10
#984195 src:libomxil-bellagio libomxil-bellagio: ftbfs with GCC-11 2021-10-10
#984199 src:libpappsomspp libpappsomspp: ftbfs with GCC-11 2021-10-10
#984201 src:libosl libosl: ftbfs with GCC-11 2021-10-10
#984203 src:libpgf libpgf: ftbfs with GCC-11 2021-10-10
#984205 src:libpsm2 libpsm2: ftbfs with GCC-11 2021-10-10
#984208 src:libsass libsass: ftbfs with GCC-11 2021-10-10
#984209 src:libsynthesis libsynthesis: ftbfs with GCC-11 2021-10-10
#984211 src:libwibble libwibble: ftbfs with GCC-11 2021-10-10
#984213 src:libvigraimpex libvigraimpex: ftbfs with GCC-11 2021-10-10
#984214 src:libzypp libzypp: ftbfs with GCC-11 2021-10-10
#984218 src:source-highlight licenseutils: ftbfs with GCC-11 2021-10-11
#984224 src:lomiri-app-launch lomiri-app-launch: ftbfs with GCC-11 2021-10-10
#984228 src:mahimahi mahimahi: ftbfs with GCC-11 2021-10-10
#984229 src:mccs mccs: ftbfs with GCC-11 2021-10-10
#984232 src:meshlab meshlab: ftbfs with GCC-11 2021-10-10
#984234 src:mediastreamer2 mediastreamer2: ftbfs with GCC-11 2021-10-10
#984237 src:mkcue mkcue: ftbfs with GCC-11 2021-10-10
#984239 src:mir mir: ftbfs with GCC-11 2021-10-10
#984242 src:mpich mpich: ftbfs with GCC-11 2021-10-10
#984243 src:mothur mothur: ftbfs with GCC-11 2021-10-22
#984244 src:mpqc mpqc: ftbfs with GCC-11 2021-10-10
#984247 src:mstflint mstflint: ftbfs with GCC-11 2021-10-10
#984248 src:mygui mygui: ftbfs with GCC-11 2021-10-10
#984253 src:ns2 ns2: ftbfs with GCC-11 2021-10-10
#984256 src:nextepc nextepc: ftbfs with GCC-11 2021-10-10
#984260 src:nut nut: ftbfs with GCC-11 2021-10-14
#984261 src:ocaml-mccs ocaml-mccs: ftbfs with GCC-11 2021-10-10
#984262 src:o3dgc o3dgc: ftbfs with GCC-11 2021-10-10
#984267 src:omniorb-dfsg omnievents: ftbfs with GCC-11 2021-10-11
#984268 src:ogmtools ogmtools: ftbfs with GCC-11 2021-10-10
#984270 src:onednn onednn: ftbfs with GCC-11 2021-10-10
#984272 src:open-vm-tools open-vm-tools: ftbfs with GCC-11 2021-10-10
#984274 src:openclonk openclonk: ftbfs with GCC-11 2021-10-19
#984275 src:openmw openmw: ftbfs with GCC-11 2021-10-10
#984276 src:opencolorio opencolorio: ftbfs with GCC-11 2021-10-10
#984278 src:openxr-sdk-source openxr-sdk-source: ftbfs with GCC-11 2021-10-10
#984279 src:openzwave openzwave: ftbfs with GCC-11 2021-10-12
#984280 src:oscar oscar: ftbfs with GCC-11 2021-10-10
#984283 src:paraview paraview: ftbfs with GCC-11 2021-10-10
#984284 src:insighttoolkit4 otb: ftbfs with GCC-11 2021-10-10
#984286 src:pcb2gcode pcb2gcode: ftbfs with GCC-11 2021-10-10
#984287 src:pepper pepper: ftbfs with GCC-11 2021-10-10
#984288 src:pdf2djvu pdf2djvu: ftbfs with GCC-11 2021-10-10
#984293 src:plink plink: ftbfs with GCC-11 2021-10-10
#984294 src:photoflow photoflow: ftbfs with GCC-11 2021-10-10
#984297 src:presage presage: ftbfs with GCC-11 2021-10-10
#984298 src:psensor psensor: ftbfs with GCC-11 2021-10-10
#984299 src:psocksxx psocksxx: ftbfs with GCC-11 2021-10-10
#984300 src:pxe-kexec pxe-kexec: ftbfs with GCC-11 2021-10-10
#984301 src:proftmb proftmb: ftbfs with GCC-11 2021-10-10
#984307 src:qpxtool qpxtool: ftbfs with GCC-11 2021-10-10
#984310 src:qtads qtads: ftbfs with GCC-11 2021-10-10
#984321 src:ring ring: ftbfs with GCC-11 2021-10-10
#984326 src:sagemath sagemath: ftbfs with GCC-11 2021-10-10
#984330 src:sight sight: ftbfs with GCC-11 2021-10-10
#984331 src:sipxtapi sipxtapi: ftbfs with GCC-11 2021-10-10
#984332 src:simdjson simdjson: ftbfs with GCC-11 2021-10-11
#984334 src:skewer skewer: ftbfs with GCC-11 2021-10-10
#984337 src:slowmovideo slowmovideo: ftbfs with GCC-11 2021-10-10
#984338 src:slic3r-prusa slic3r-prusa: ftbfs with GCC-11 2021-10-10
#984339 src:slim slim: ftbfs with GCC-11 2021-10-10
#984345 src:sphde sphde: ftbfs with GCC-11 2021-10-10
#984352 src:srt srt: ftbfs with GCC-11 2021-10-10
#984359 src:systemc systemc: ftbfs with GCC-11 2021-10-10
#984366 src:thin-provisioning-tools thin-provisioning-tools: ftbfs with GCC-11 2021-10-10
#984370 src:tvc tvc: ftbfs with GCC-11 2021-10-10
#984372 src:tripwire tripwire: ftbfs with GCC-11 2021-10-21
#984373 src:ucommon ucommon: ftbfs with GCC-11 2021-10-10
#984382 src:vdr vdr: ftbfs with GCC-11 2021-10-10
#984383 src:vdr-plugin-dvbhddevice vdr-plugin-dvbhddevice: ftbfs with GCC-11 2021-10-10
#984384 src:varconf varconf: ftbfs with GCC-11 2021-10-10
#984385 src:vdr-plugin-dvd vdr-plugin-dvd: ftbfs with GCC-11 2021-10-10
#984386 src:vdr-plugin-epgsearch vdr-plugin-epgsearch: ftbfs with GCC-11 2021-10-10
#984387 src:vdr-plugin-femon vdr-plugin-femon: ftbfs with GCC-11 2021-10-10
#984388 src:vdr-plugin-live vdr-plugin-live: ftbfs with GCC-11 2021-10-10
#984389 src:vdr-plugin-mp3 vdr-plugin-mp3: ftbfs with GCC-11 2021-10-10
#984390 src:vdr-plugin-satip vdr-plugin-satip: ftbfs with GCC-11 2021-10-10
#984391 src:vdr-plugin-remote vdr-plugin-remote: ftbfs with GCC-11 2021-10-10
#984392 src:vdr-plugin-streamdev vdr-plugin-streamdev: ftbfs with GCC-11 2021-10-10
#984393 src:vdr-plugin-xineliboutput vdr-plugin-xineliboutput: ftbfs with GCC-11 2021-10-10
#984395 src:vdr-plugin-vcd vdr-plugin-vcd: ftbfs with GCC-11 2021-10-10
#984396 src:vdr-plugin-xine vdr-plugin-xine: ftbfs with GCC-11 2021-10-10
#984398 src:vtk6 vtk6: ftbfs with GCC-11 2021-10-10
#984400 src:w1retap w1retap: ftbfs with GCC-11 2021-10-10
#984401 src:vtk7 vtk7: ftbfs with GCC-11 2021-10-16
#984402 src:wine wine: ftbfs with GCC-11 2021-10-10
#984403 src:warzone2100 warzone2100: ftbfs with GCC-11 2021-10-10
#984406 src:zookeeper zookeeper: ftbfs with GCC-11 2021-10-10
#984410 src:zeromq3 zeromq3: ftbfs with GCC-11 2021-10-10
#984411 src:wlcs wlcs: ftbfs with GCC-11 2021-10-10
#984413 src:wings3d wings3d: ftbfs with GCC-11 2021-10-10
#984415 src:zbackup zbackup: ftbfs with GCC-11 2021-10-10
#984418 src:xqilla xqilla: ftbfs with GCC-11 2021-10-10
#984421 src:yade yade: ftbfs with GCC-11 2021-10-10
#984423 src:webcamoid webcamoid: ftbfs with GCC-11 2021-10-10
#984505 cpl-plugin-amber-calib cpl-plugin-amber-calib: amber-kit-4.3.8*.tar.gz no longer downloadable 2021-03-04
#984506 cpl-plugin-fors-calib cpl-plugin-fors-calib: fors-kit-5.3.32*.tar.gz no longer downloadable 2021-03-04
#984519 cpl-plugin-giraf-calib cpl-plugin-giraf-calib: giraf-kit-2.16.3*.tar.gz no longer downloadable 2021-03-04
#984520 grub-efi-amd64 'error: symbol "grub_register_command_lockdown" not found' and then lightdm fails to start 2021-09-07
#984521 cpl-plugin-naco-calib cpl-plugin-naco-calib: naco-kit-4.4.6*.tar.gz is no longer downloadable 2021-03-04
#984523 cpl-plugin-uves-calib cpl-plugin-uves-calib: uves-kit-5.9.1*.tar.gz no longer downloadable 2021-03-04
#984524 cpl-plugin-vimos-calib cpl-plugin-vimos-calib: vimos-kit-3.2.3*.tar.gz no longer downloadable 2021-03-04
#984525 cpl-plugin-visir-calib cpl-plugin-visir-calib: visir-kit-4.3.7*.tar.gz no longer downloadable 2021-03-04
#984527 cpl-plugin-xshoo-calib cpl-plugin-xshoo-calib: xshoo-kit-3.2.0*.tar.gz no longer downladable 2021-03-04
#984545 cpl-plugin-hawki-calib cpl-plugin-hawki-calib: hawki-kit-2.4.3*.tar.gz no longer downloadable 2021-03-04
#984548 movim movim: fails to upgrade from 'buster': package post-installation script subprocess returned error exit status 1 2021-03-04
#984606 sword-comm-scofield sword-comm-scofield: Missing source 2021-08-22
#984608 sword-comm-tdavid sword-comm-tdavid: Missing source 2021-08-22
#984609 openrocket openrocket: uninstallable: depends on no longer available openjdk-8-jre 2021-03-05
#984622 src:rust-derive-more rust-derive-more uninstallable, unmigratable due to missing rust-peg 2021-03-15
#984714 gparted gparted should suggest exfatprogs and backport the commit that rejects exfat-utils 2021-08-14
#984742 src:rust-sha-1 rust-sha-1: several B-D are no longer available 2021-03-07
#984760 grub-efi-amd64 grub-efi-amd64: upgrade works, boot fails (error: symbol `grub_is_lockdown` not found) 2021-09-06
#984771 src:rust-nom-3 rust-nom-3: depends on multiple unavailable packages 2021-03-08
#984810 courier-authlib courier-authlib: CVE-2021-28374: /run/courier/authdaemon directory with weak permissions 2021-03-15
#984828 gitlab gitlab: code tree not rendered (circling circle instead) 2021-03-09
#984865 src:rust-tui rust-tui: depends on multiple unavailable packages 2021-03-09
#984866 src:rust-diesel rust-diesel: depends on multiple unavailable packages 2021-03-10
#984913 librust-backtrace+rustc-dep-of-std-dev librust-backtrace+rustc-dep-of-std-dev: depends on unavailable librust-cfg-if-0.1+rustc-dep-of-std-dev 2021-03-10
#984914 src:rust-combine rust-combine: depends on multiple unavailable packages 2021-03-10
#984919 src:rust-cookie rust-cookie: depends on multiple unavailable packages 2021-03-10
#984921 src:rust-libsqlite3-sys rust-libsqlite3-sys: depends on multiple unavailable packages 2021-03-10
#984953 gparted libgtkmm-3.0-1v5: GParted crashes on Gdk::Pixbuf::get_width() const () 2021-08-14
#984982 src:plexus-languages plexus-languages: Build-Depends on no longer available libsisu-maven-plugin-java 2021-03-11
#985173 pacemaker-resource-agents pacemaker-resource-agents: missing Breaks+Replaces: pacemaker (<< 2) 2021-05-09
#985223 src:phpldapadmin phpldapadmin: maintained by NMUs, has security issues, new upstream versions available 2021-03-14
#985262 librust-migrations-internals+barrel-dev librust-migrations-internals+barrel-dev: depends on unavailabe librust-barrel+default-dev 2021-03-15
#985263 librust-num-bigint+quickcheck-macros-dev librust-num-bigint+quickcheck-macros-dev: depends on unavailable librust-quickcheck-macros-0.8-dev 2021-03-15
#985264 librust-html2text-dev librust-html2text-dev: depends on unavailable librust-clippy-0.0.302+default-dev 2021-03-15
#985309 src:rust-kamadak-exif CVE-2021-21235 2021-03-16
#985377 src:gitlab-ci-multi-runner CVE-2020-13327 2021-03-16
#985520 shove shove: broken symlink: /usr/bin/shove -> ../share/shove/bin/shove 2021-03-19
#985522 zeek-aux zeek-aux: broken symlink: /usr/bin/bro-cut -> zeek-wrapper 2021-04-08
#985693 libhsa-runtime-dev libhsa-runtime-dev: broken symlink: /usr/lib/libhsa-runtime64.so -> libhsa-runtime64.so.1.1.9 2021-03-22
#985704 request-tracker5 request-tracker5: broken symlinks: /usr/share/dbconfig-common/scripts/request-tracker5/upgrade/{pgsql,sqlite3}/4.5.[0-7] -> ../mysql/4.5.[0-7] 2021-03-22
#985725 src:slurm-wlm slurm-wlm: flaky autopkgtest: srun: Required node not available (down, drained or reserved) 2021-08-16
#985737 pymeeus convertdate: autopkgtest failure 2021-03-23
#985760 amd64-microcode amd64-microcode: jessie-lts has newer version than stretch(-lts) 2021-03-22
#985813 rust-libnotcurses-sys rust-libnotcurses-sys FTBFS ffi related errors. 2021-03-24
#985840 gitlab-shell gitlab-shell: should not ship /usr/bin/check 2021-08-28
#985864 trove-common trove-common: fails to install: install: cannot stat '/usr/share/trove-common/trove-guestagent.conf': No such file or directory 2021-04-16
#985880 ruby-flot-rails ruby-flot-rails: broken symlinks: /usr/share/ruby-flot-rails/vendor/assets/javascripts/jquery.flot.canvas.* -> ../../../../javascript/jquery-flot/jquery.flot.canvas.* 2021-03-25
#985891 dicompyler dicompyler doesn't start 2021-04-26
#986070 protobuf2 protobuf2: unsuitable for release 2021-03-29
#986097 libphp8.0-embed libphp8.0-embed: unusual unversioned soname: libphp.so 2021-06-15
#986130 fetchmailconf fetchmailconf: No update/upgrade possible due to error 2021-03-30
#986182 zaqar-common zaqar-common: fails to install: install: cannot stat '/usr/share/zaqar-common/policy.json': No such file or directory 2021-04-16
#986436 node-tldjs node-tldjs: modifies shipped files: /usr/lib/nodejs/tldjs/rules.json 2021-04-23
#986485 lego Lego in Debian stable unusable due to ACMEv1 deprecation 2021-05-09
#986512 src:vala vala: 0.48.14 pyobject regression cause FTBFS on libunity 2021-05-17
#986527 src:sagemath testsuite is too fragile - FTBFS randomly 2021-08-27
#986529 src:gvm-libs gvm-libs: gvm packages not suitable for stable Debian release 2021-04-07
#986590 src:dbus-test-runner dbus-test-runner: flaky ppc64el autopkgtest: FAIL test-libdbustest-mock-test (exit status: 1) 2021-08-16
#986695 prometheus-mongodb-exporter prometheus-mongodb-exporter: MongoDB exporter segfaults when connecting with relatively recent MongoDB databases 2021-04-24
#986709 src:rsnapshot rsnapshot: not suitable for stable release 2021-10-01
#986873 src:librsvg librsvg: FTFBS with current rustc in Buster (1.41.1+dfsg1-1~deb10u1) 2021-04-13
#987008 grub2 Grub fails to find LVM volume after previous LV rename 2021-09-24
#987009 courier-authlib courier-authlib: the purported fix for #984810 breaks maildrop "delivery mode" 2021-05-29
#987062 apt apt: fails to upgrade guile-2.2-libs from buster to bullseye 2021-06-08
#987217 src:nvidia-graphics-drivers-legacy-340xx nvidia-graphics-drivers-legacy-340xx: CVE-2021-1076 2021-04-19
#987275 src:rust-diesel CVE-2021-28305 2021-04-21
#987325 src:mysql-8.0 mysql-8.0: Security fixes from the April 2021 CPU 2021-07-23
#987353 src:google-compute-image-packages CVE-2020-8903 CVE-2020-8907 CVE-2020-8933 2021-05-16
#987360 swaylock swaylock: Occassional unlock without password entered 2021-08-17
#987379 src:llvm-toolchain-12 llvm-toolchain-11 autopkgtest segfaults on armhf 2021-04-22
#987465 src:matrix-construct matrix-construct: Uses non-default boost 2021-04-24
#987525 src:binutils64 binutils64: Missing Built-Using for binutils 2021-04-25
#987526 src:binutils64 binutils64 FTBFS: Failed to apply patches 2021-04-25
#987570 openjdk-11-jre-headless openjdk-11-jre-headless: libawt_xawt.so still listed as part of this package instead of openjdk-11-jre 2021-05-29
#987602 src:ca-certificates ca-certificates-java,default-jre-headless,openjdk-11-jre-headless: get rid of the circular dependency 2021-08-14
#987816 src:dask.distributed dask.distributed: FTBFS due to a build-time test failure 2021-09-10
#987819 mate-optimus mate-optimus: Program is broken on Debian as prime-select doesn't exist 2021-04-30
#987939 src:cgminer cgminer: fails to build from the source 2021-05-02
#987967 node-jade jade replaced by pug for ages, doesn't work anymore 2021-10-08
#988021 src:mongo-tools mongo-tools: CVE-2020-7924 2021-05-03
#988023 src:ruby-hiredis ruby-hiredis FTBFS in buster 2021-05-03
#988028 src:ruby-riddle ruby-riddle FTBFS in buster: Mysql2::Error: Load data local infile forbidden 2021-05-03
#988094 chkservice reportbug: chkservice fails to control certain services 2021-06-22
#988142 src:pandas pandas FTBFS in buster: test failures 2021-05-09
#988145 src:libmail-dkim-perl libmail-dkim-perl in buster accesses the internet during the build 2021-05-06
#988149 src:mozjs60 mozjs60: Missing build dependency on tzdata 2021-05-06
#988156 brz-loom breezy breaks breezy-loom autopkgtest: FAILED (failures=4) 2021-08-16
#988246 src:wine-development wine-development: not intended for a stable release 2021-05-08
#988440 src:golang-github-seccomp-containers-golang golang-github-seccomp-containers-golang: Keep out of bookworm 2021-05-13
#988462 trac trac: not ready for Debian 11 2021-05-13
#988512 ca-cacert ca-cacert: class3 certificate will expire soon (on May 20 17:48:02 2021 GMT) 2021-06-14
#988716 platformio platformio 4.3.4 cannot download required frameworks 2021-05-31
#988729 src:rust-hyper CVE-2021-21299 2021-05-24
#988905 src:request-tracker5 src:request-tracker5: ftbfs due to changes in gpg error messages 2021-07-12
#988945 src:rust-http CVE-2019-25009 2021-06-23
#988950 src:golang-github-nats-io-jwt CVE-2020-26892 CVE-2020-26521 2021-05-21
#989011 src:ksudoku ksudoku FTBFS on armhf in buster 2021-05-23
#989115 ntopng-data ntopng-data: broken symlinks: /usr/share/ntopng/httpdocs/font-awesome/fonts/fontawesome-webfont.* and others 2021-05-26
#989166 r-cran-gtools Error: package or namespace load failed for ‘gtools’ 2021-05-27
#989344 libogre-1.12 libogre-1.12: package name does not match soname 2021-07-14
#989434 src:libsepol libsepol 3.2: cherry-pick fix for role attributes 2021-06-03
#989733 webpack webpack: Error: Cannot find module 'array-back' 2021-06-11
#989736 src:openjdk-8 openjdk-8: keep out of testing and stable 2021-06-15
#989786 ruby-spamcheck ruby-spamcheck: cannot use ruby-grpc package 2021-06-13
#989792 src:dqlite dqlite assumes a kernel configured with 4kB page size 2021-08-01
#989830 apt apt: fails to upgrade libmrpt-dev from buster to bullseye 2021-06-14
#989852 src:xorg-server xorg-server-source: Cannot build X from provided source tarball 2021-06-15
#989872 src:thunderbird thunderbird-dbgsym: uninstallable cruft package in buster 2021-06-19
#989880 cpl-plugin-muse-calib cpl-plugin-muse-calib: muse-kit-2.6*.tar.gz no longer downloadable 2021-06-22
#990017 grub-ieee1275 [REGRESSION] Bullseye CD installer images fail to install GRUB on OpenPOWER machines 2021-08-14
#990026 cron cron: Reduced charset in MAILTO causes breakage 2021-08-14
#990053 yowsup-cli yowsup-cli: Fails to registrate: missing autkey 2021-08-25
#990123 iptables-netflow-dkms [buster regression] iptables-netflow-dkms: No more compiles since linux-*-4.19.0-17-*: "implicit declaration of function ‘ref_module’" (Upstream kernel API regression in 4.19.191?) 2021-07-02
#990183 libopenscap8 libopenscap8: libopenscap.so.8 is missing from libopenscap8 and is expected by scap-workbench 2021-08-06
#990201 src:singularity-container singularity-container: CVE-2021-33622 2021-06-22
#990224 lazarus-src-2.0 lazarus-src-2.0: leaves diversion after upgrade from sid to experimental 2021-06-23
#990228 ssl-cert openssl: breaks ssl-cert installation: 8022CB35777F0000:error:1200007A:random number generator:RAND_write_file:Not a regular file:../crypto/rand/randfile.c:190:Filename=/dev/urandom 2021-07-14
#990318 python-pkg-resources python-pkg-resources: please add Breaks against the unversioned python packages 2021-08-14
#990340 glances glances: contains prebuilt javascript without source 2021-08-30
#990345 src:zookeeper zookeeper: various security issues 2021-08-01
#990351 nheko nheko: Missing dependencies breaks room loading 2021-07-11
#990382 src:rust-file-diff rust-file-diff FTBFS 2021-06-27
#990409 ca-cacert ca-cacert: should this package be removed? 2021-08-15
#990419 puppetdb CVE-2021-27021 2021-07-02
#990443 origami-pdf origami-pdf: pdfwalker crashes on start: /usr/lib/ruby/vendor_ruby/rubygems/core_ext/kernel_require.rb:85:in `require': superclass mismatch for class Socket (TypeError) 2021-06-29
#990525 src:libgrokj2k libgrokj2k: CVE-2021-36089 2021-07-17
#990691 src:gpac gpac: CVE-2020-35980 2021-07-17
#990746 thawab /usr/bin/thawab-gtk: thawab fails to start. 2021-07-07
#990792 src:redmine redmine: CVE-2021-31863 CVE-2021-31864 CVE-2021-31865 CVE-2021-31866 2021-07-07
#990872 puppetdb puppetdb.jar crashes out of the box with clojure classpath error 2021-09-11
#991000 bareos-database-common bareos-database-common: fails to upgrade from buster: ERROR: invalid value for parameter "client_min_messages": "fatal" 2021-07-12
#991003 kpatch-dkms kpatch-dkms: fails to build module for Linux 4.19.0-17 or newer: find_symbol is no longer exported by the kernel 2021-07-15
#991036 src:libhandy libhandy: Should this package be removed in bookworm? 2021-09-22
#991057 src:gri gri FTBFS with imagemagick with the #987504 change 2021-10-22
#991060 src:mlpost mlpost FTBFS with imagemagick with the #987504 change 2021-08-14
#991066 src:vlfeat vlfeat FTBFS with imagemagick with the #987504 change 2021-09-08
#991082 gir1.2-gtd-1.0 gir1.2-gtd-1.0 has empty Depends 2021-08-14
#991113 libpam-chroot libpam-chroot installs pam_chroot.so into the wrong directory 2021-09-08
#991151 procps procps: dropped the reload option from the init script, breaking corekeeper 2021-08-14
#991212 python3-myhdl python3-myhdl: myhdl always crashes in python3.9/ast.py 2021-07-17
#991245 diaspora diaspora fails to handle triggers in postinst 2021-07-18
#991344 src:umatrix umatrix: CVE-2021-36773: Denial of Service 2021-09-04
#991352 src:nvidia-graphics-drivers-legacy-340xx nvidia-graphics-drivers-legacy-340xx: CVE-2021-1093, CVE-2021-1094, CVE-2021-1095 2021-07-21
#991358 guile-2.2 guile-2.2 should not be in bookworm 2021-07-21
#991361 postfix postfix should not use HELO localhost.localdomain 2021-07-21
#991384 libwine-development libwine-development fails to install on arm*: head: cannot open '/usr/aarch64-w64-mingw32/lib/zlib*.dll' for reading: No such file or directory 2021-07-22
#991449 fail2ban fix for CVE-2021-32749 breaks systems with mail from bsd-mailx 2021-08-14
#991450 src:ubertooth gcc-arm-none-eabi breaks ubertooth autopkgtest: linking error 2021-09-08
#991478 shim-signed [shim-signed] RFE: do not brick users' systems in the stable distribution 2021-08-14
#991505 src:bind bind: duplicate, old version of bind9 source package, remove from experimental? 2021-07-26
#991541 src:php-pear php-pear: CVE-2021-32610: symbolic link path traversal 2021-07-27
#991610 postfix postfix: TLS_LICENSE is not included in /usr/share/doc/postfix/copyright 2021-08-14
#991650 src:python-django-imagekit python-django-imagekit: FTBFS: dh_auto_test: error: pybuild --test -i python{version} -p 3.9 returned exit code 13 2021-08-16
#991744 gitlab gitlab-workhorse: contains non-free image testdata/image.svg 2021-07-31
#991822 src:wine src:wine: dh_auto_clean deletes unrelated files outside of package source 2021-08-29
#991823 src:wine-development src:wine: dh_auto_clean deletes unrelated files outside of package source 2021-08-02
#991900 prism2-usb-firmware-installer prism2-usb-firmware-installer: missing Depends: ca-certificates 2021-10-04
#991936 openssh-server openssh-server: seccomp filter defaults to SIGSYS, could break any libc or kernel upgrade 2021-08-19
#992046 src:rust-anymap rust-anymap: CVE-2021-38187 2021-08-10
#992089 src:xemacs21-packages xemacs21-packages: contains a file with a non-free "disparaging to Sun" license 2021-08-16
#992090 libskinlf-java libskinlf-java: contains a file with a non-free "disparaging to Sun" license 2021-08-16
#992097 mlton-compiler mlton-compiler is not installable 2021-08-11
#992150 src:firefox-esr Please allow symlink in system extension 2021-08-16
#992164 calamares calamares: Creating a new blank partition table GPT/UEFI results in failure 2021-08-14
#992229 src:haskell-gi-gdkpixbuf haskell-gi-gdkpixbuf FTBFS: Could not find module ‘GI.GModule.Structs.Module’ 2021-08-16
#992239 src:mysql-8.0 Security fixes from the July 2021 CPU 2021-08-16
#992247 src:patchage patchage FTBFS: error: conversion from ‘iterator_base<Ganv::Port,_GanvPort>’ to non-scalar type ‘iterator_base<const Ganv::Port,const _GanvPort>’ requested 2021-08-16
#992297 src:gitit gitit: CVE-2021-38711 2021-09-13
#992442 bzip2 bzip2: Use tempfile in /usr/bin/bzexe, which is no longer available 2021-09-02
#992508 src:units-filter units-filter FTBFS: dh_installdocs: error: Cannot find (any matches for) "README" (tried in ., debian/tmp) 2021-10-14
#992535 src:kore kore: autopkgtest started to time out since the ci.d.n host runs bullseye 2021-08-22
#992564 src:caml-crush FTBFS: "rpc/rpc.h" not found (removed from glibc 2.32) 2021-08-20
#992592 lightdm lightdm fails to start after update to bullseye (missing '/var/lib/lightdm/data') 2021-08-20
#992668 ricochet-im ricochet-im: does not start 2021-10-10
#992673 src:libgpuarray libgpuarray: *gemv broken on libclblast 2021-08-30
#992676 src:scipy, src:python-skbio scipy breaks python-skbio autopkgtest: Unsupported dtype object 2021-10-14
#992786 src:passenger passenger uses many vendored libraries 2021-08-25
#992798 src:initramfs-tools initramfs-tools: please drop shellcheck autopkgtest 2021-09-13
#992896 src:etbemon etbemon: FTBFS due to RPC removal from glibc 2021-08-24
#992901 src:geary src:geary: fails to migrate to testing for too long due to ftbfs on armel 2021-09-06
#992905 src:perceptualdiff src:perceptualdiff: fails to migrate to testing for too long due to ftbfs 2021-09-22
#992924 src:freefem++ freefem++: autopkgtest failure on arm64/ppc64el 2021-08-29
#992927 mutt mutt: Mutt 2.1.2 is available, fixing a potential data-loss IMAP bug 2021-09-08
#993003 src:hydroffice.bag hydroffice.bag: tests fail with h5py 3 2021-09-23
#993004 src:yt yt: tests fail with h5py 3 2021-08-29
#993014 src:cifs-utils cifs-utils non-parallel FTBFS 2021-08-26
#993015 src:kwin-effect-xrdesktop kwin-effect-xrdesktop FTBFS with kwin 5.21.5 2021-08-26
#993029 ranger ranger: No preview for mp(e)g files (mime-type: image/x-tga) and fs saturation with .pam files 2021-10-07
#993033 src:libmcrypt libmcrypt FTBFS: autoreconf failure 2021-08-27
#993042 src:nim nim FTBFS on armhf when built on arm64 hardware 2021-10-19
#993061 src:gnome-shell-extension-easyscreencast gnome-shell-extension-easyscreencast: Not compatible with gnome-shell 40 2021-09-12
#993065 src:gnome-shell-extension-xrdesktop gnome-shell-extension-xrdesktop: Please update for gnome-shell 40 2021-10-10
#993088 src:tootle tootle FTBFS: error: The name `get_phrase' does not exist in the context of `Soup.Status' 2021-09-17
#993094 src:sdl-mixer1.2 sdl-mixer1.2 FTBFS: autoreconf failure 2021-08-28
#993147 src:libstatgrab libstatgrab FTBFS: ./configure: line 7892: syntax error near unexpected token `ac_fn_check_decl' 2021-08-28
#993149 src:sagemath sagemath FTBFS with eclib 20210625-1 2021-08-27
#993176 src:libssh2 libssh2 FTBFS: configure.ac:130: error: m4_undefine: undefined macro: backend 2021-10-21
#993185 gnome-shell-extension-desktop-icons gnome-shell-extension-desktop-icons: does not declare compatibility with GNOME Shell 40 2021-09-11
#993187 gnome-shell-extension-hide-activities gnome-shell-extension-hide-activities: does not declare compatibility with GNOME Shell 40 2021-09-20
#993189 gnome-shell-extension-hide-veth gnome-shell-extension-hide-veth: does not declare compatibility with GNOME Shell 40 2021-09-12
#993191 gnome-shell-extension-move-clock gnome-shell-extension-move-clock: does not declare compatibility with GNOME Shell 40 2021-09-12
#993192 gnome-shell-extension-multi-monitors gnome-shell-extension-multi-monitors: does not declare compatibility with GNOME Shell 40 2021-09-12
#993194 gnome-shell-extension-panel-osd gnome-shell-extension-panel-osd: does not declare compatibility with GNOME Shell 40 2021-10-10
#993196 gnome-shell-extension-remove-dropdown-arrows gnome-shell-extension-remove-dropdown-arrows: unnecessary with GNOME Shell 40 2021-10-21
#993199 gnome-shell-extension-tilix-dropdown gnome-shell-extension-tilix-dropdown: does not declare compatibility with GNOME Shell 40 2021-09-12
#993200 gnome-shell-extension-tilix-shortcut gnome-shell-extension-tilix-shortcut: does not declare compatibility with GNOME Shell 40 2021-09-11
#993201 gnome-shell-extension-trash gnome-shell-extension-trash: does not declare compatibility with GNOME Shell 40 2021-10-14
#993204 gnome-shell-timer gnome-shell-timer: does not declare compatibility with GNOME Shell 40 2021-10-17
#993241 src:minidlna minidlna FTBFS: configure: error: Could not find libid3tag 2021-08-29
#993247 src:gnunet FTBFS in sid (libunistring) 2021-10-18
#993274 upgrade-reports machine unbootable after upgrade 2021-08-30
#993301 src:prototypejs prototypejs: FTBFS 2021-08-30
#993323 src:libmath-gsl-perl libmath-gsl-perl: FTBFS: Unsupported GSL version!!! : 2.7 2021-10-19
#993324 libgsl25 libgsl25: ABI breakage: removed symbol gsl_linalg_QR_TR_decomp 2021-10-16
#993350 xsane xsane: Scanimage detects scanner but Xsane won't start it 2021-10-05
#993355 src:haskell-hgettext haskell-hgettext: autopkgtest regressed in August 2020 2021-09-01
#993379 src:libyami-utils libyami-utils FTBFS: error: ‘void av_init_packet(AVPacket*)’ is deprecated [-Werror=deprecated-declarations] 2021-08-31
#993435 python3-etesync-dav unsatisfied installation dependencies: python3-flask-wtf 2021-09-01
#993505 src:netgen-lvs netgen-lvs FTBFS: configure: error: cannot find required auxiliary files: install-sh config.guess config.sub 2021-09-05
#993559 ganeti-3.0 ganeti-3.0 unable to remove a dpkg-divert during postrm when 2.16 is still there 2021-09-03
#993578 gpg-agent 90gpg-agent generator: `gpgconf --check-programs` can hang 2021-09-23
#993616 gnome-software gnome-software: cannot resolve http://ftp.us/debian.org 2021-09-03
#993630 isso isso depends on deprecated node-jade which is going to be removed 2021-09-03
#993659 src:firefox-esr firefox-esr: FTBFS and embeded copy of code 2021-09-07
#993660 src:firefox-esr firefox-esr: FTBFS and embeded copy of code 2021-09-05
#993661 src:drbd-doc drbd-doc: Build-Depends on obsolete libgtkmathview-bin 2021-09-05
#993693 webpack ReferenceError: options is not defined 2021-09-04
#993699 src:libxtrx libxtrx: FTBFS with libsoapysdr 0.8 2021-09-15
#993701 src:srslte srslte: FTBFS with libsoapysdr 0.8 2021-09-08
#993716 bridge-utils bridge-utils: IPv6 network bridge fails after upgrading Buster to Bullseye 2021-09-06
#993724 gnome-shell-extension-desktop-icons crashes when I click on PDF-files 2021-09-15
#993818 ruby-nokogiri ruby-nokogiri: WARNING: Nokogiri was built against libxml version 2.9.12, but has dynamically loaded 2.9.10 2021-09-19
#993835 src:rnp rnp FTBFS: rnp_tests.test_key_add_userid (Failed) 2021-09-07
#993874 src:slurm flurm FTBFS with glibc 2.32: fatal error: sys/sysctl.h: No such file or directory 2021-10-13
#993882 virt-manager power64le: virt-manager refuses to start fresh install of FreeBSD 13.0 due to qemu issue on power8 host (safe cache missing) 2021-09-07
#993967 tortoisehg License incompatible with PyQt5 2021-10-12
#994055 src:cunit cunit: FTBFS: format not a string literal and no format arguments [-Werror=format-security] 2021-10-13
#994057 libegl-mesa0 libegl-mesa0: 21.2.1-2 with intel graphic card produces artifact on firefox-esr 2021-09-22
#994062 gnome-shell-extension-tilix-dropdown gnome-shell-extension-tilix-dropdown: No JS module 'tweener' found in search path 2021-09-10
#994093 libgradle-android-plugin-java libgradle-android-plugin-java: tries to use removed method setDependencyCacheDir() 2021-09-11
#994108 src:gcc-9 gcc-9: do not release with bookworm 2021-09-25
#994119 vdirsyncer vdirsyncer: Random cannot import name 'metasync' with python3.9 2021-09-27
#994134 gcc-9-cross gcc-9-cross: do not release with bookworm 2021-09-12
#994135 gcc-9-cross-ports gcc-9-cross-ports: do not release with bookworm 2021-09-12
#994171 elpa-jedi-core elpa-jedi-core incompatible with python3-jedi in bullseye 2021-09-13
#994178 libnginx-mod-http-lua libnginx-mod-http-lua - init_worker_by_lua_block segfaults 2021-10-18
#994193 src:iptstate iptstate FTBFS: error: format not a string literal and no format arguments [-Werror=format-security] 2021-10-16
#994194 src:hexcurse hexcurse FTBFS: error: format not a string literal and no format arguments [-Werror=format-security] 2021-10-13
#994212 r-cran-gprofiler r-cran-gprofiler: Obsolete package, replaced with r-cran-gprofiler2 2021-09-16
#994213 src:node-matrix-js-sdk node-matrix-js-sdk: CVE-2021-40823: E2EE vulnerability 2021-09-13
#994214 src:nomad nomad FTBFS in unstable 2021-09-16
#994223 python3-breezy lintian-brush is unusable 2021-09-16
#994237 src:criterion fix ftbfs with GCC 11 2021-10-10
#994239 src:micropython work around ftbfs with GCC 11 2021-10-10
#994241 ruby-lapack ruby-lapack autopkgtest needs to be adapted for LAPACK 3.10 2021-09-14
#994257 src:python-django, src:django-ldapdb python-django breaks django-ldapdb autopkgtest: 'Field' object has no attribute 'attname' 2021-10-21
#994258 lava-server lava-server fails to install with python3-django 3.2 2021-10-20
#994266 src:pyjwt, src:azure-cli pyjwt breaks azure-cli autopkgtest: Could not deserialize key data. The data may be in an incorrect format or it may be encrypted with an unsupported algorithm. 2021-10-03
#994274 src:syslinux syslinux: FTBFS with gnu-efi 3.0.13 2021-09-16
#994276 xutils-dev xutils-dev: imake shouldn't pass l to ar 2021-10-10
#994286 r-bioc-destiny r-bioc-destiny: Orphaned upstream, marked for removal in next BioConductor release 2021-09-15
#994391 vdirsyncer vdirsyncer is unusable 2021-10-10
#994423 src:pytorch pytorch: Baseline violation on armhf 2021-10-14
#994443 src:r-bioc-deseq2 r-bioc-deseq2: autopkgtest regression 2021-10-22
#994451 golang-github-containers-common golang-github-containers-common: secomp.json does not include newer syscall used by stable kernel/glibc on arm 2021-09-29
#994456 src:ruby-stackprof ruby-stackprof: flaky autopkgtests 2021-09-16
#994510 libunwind8 libunwind8 abuses setcontext() causing SIGSEGV on i386 with glibc >= 2.32 2021-09-16
#994521 ledmon ledmon: libsgutils2-2 1.46 update breaks ledmon 2021-10-15
#994559 src:dub dub ftbfs with gdc-11 2021-10-10
#994672 src:open-isns open-isns FTBFS: error: ‘sigrelse’ is deprecated 2021-09-20
#994676 src:gdisk gdisk FTBFS: error: format not a string literal and no format arguments [-Werror=format-security] 2021-10-13
#994677 src:ladvd ladvd FTBFS: error: ‘MAXPATHLEN’ undeclared 2021-10-18
#994736 src:libmath-gsl-perl libmath-gsl-perl: FTBFS on several architectures: undefined symbol: gsl_matrix_char_norm1 2021-10-12
#994758 libsgutils2-2 Soname change without package name change 2021-09-20
#994783 src:gammapy astropy-regions breaks gammapy autopkgtest: KeyError: '.' 2021-10-04
#994785 src:python-ase python-ase: autopkgtest regression on arm64/ppc64el: TestSlab.test_vibration_on_surface 2021-09-30
#994790 src:hcxtools hcxtools: CVE-2021-32286 2021-10-19
#994795 w3-dtd-mathml w3-dtd-mathml: invalid redeclaration of predefined entities amp and lt yields failures with libxml2 2.9.12 2021-10-07
#994799 firefox-esr FTBFS on i386 2021-09-21
#994833 intel-opencl-icd OpenCL programs abort when intel-opencl-icd is installed 2021-10-14
#994835 libjpeg62-turbo-dev libjpeg62-turbo-dev: jpeglib.h should include stdio.h 2021-10-05
#994841 src:sqlparse sqlparse: CVE-2021-32839 2021-09-21
#994855 zfs-dkms zfs-dkms: Panic when receiving, fixed upstream 2021-09-22
#994866 gmerlin-data, libgmerlin-dev gmerlin-data,libgmerlin-dev: both ship /usr/share/gmerlin/plugin.sym 2021-09-22
#994877 dokuwiki dokuwiki: During install error /var/lib/dpkg/info/dokuwiki.postinst:123 tempfile: not found 2021-09-25
#994910 tripwire tripwire segfaults while reading files in /etc 2021-10-21
#994930 guile-2.2 guile-2.2: FTBFS due to web-server.test error 2021-09-25
#994999 src:virtualbox linux-image-5.14.0-1-amd64-signed break the kernel (virtual machines) 2021-09-29
#995014 src:zfs-linux linux/linux-signe-* break zfs-linux autopkgtest: None of the expected "capability" interfaces were detected 2021-09-26
#995015 dnsdiag dnsdiag: Error when running: DeprecationWarning 2021-10-20
#995017 src:gpyfft gpyfft: autopkgtest regression on armhf: Aborted 2021-09-24
#995021 src:osmnx osmnx: autopkgtest regression on armhf: iteration over a 0-d array 2021-10-14
#995040 src:iverilog iverilog FTBFS: configure: error: C preprocessor "/lib/cpp" fails sanity check 2021-09-25
#995050 src:ecere-sdk ecere-sdk FTBFS with gcc 10 2021-09-25
#995061 gcc-9-doc gcc-9-doc: do not release with bookworm 2021-09-25
#995073 gitlab gitlab: yarnpkg fails with error An unexpected error occurred: "Release not found: 2.4.2". 2021-09-27
#995113 dpkg-sig dpkg-sig: mangles "Files" field of .changes files, but not "Checksums-*" 2021-09-26
#995115 libruby2.7 /usr/bin/ruby: symbol lookup error: /lib/x86_64-linux-gnu/libruby-2.7.so.2.7: undefined symbol: rb_st_numhash 2021-10-03
#995123 src:cyrus-sasl2 cyrus-sasl2 FTBFS: sphinx: AttributeError: 'CyrusManualPageBuilder' object has no attribute 'settings' 2021-10-01
#995139 python-librtmp python-librtmp build-depends on removed package 2021-09-27
#995165 key-mapper key-mapper: file conflict with unrelated package 'keymapper': /usr/lib/python3/dist-packages/keymapper/__init__.py 2021-09-27
#995167 request-tracker5 new upstream (5.0.2) [CVE-2021-38562] 2021-09-27
#995202 src:horst horst FTBFS: error: format not a string literal and no format arguments 2021-10-14
#995220 ts-node FTBFS: build broken by typescript update 2021-09-28
#995223 src:libffi libffi: autoconf incompatibility causes baseline violation 2021-10-11
#995224 src:relion-cuda relion-cuda: FTBFS with cub 1.14 2021-09-28
#995242 isc-dhcp-server isc-dhcp-server: omshell returns inconsistent results or segfaults 2021-10-14
#995281 src:lomiri-download-manager lomiri-download-manager: FTBFS due to symbols changes 2021-10-01
#995317 apertium apertium broken on s390x due to missing endianness definition 2021-09-29
#995318 src:numpy numpy: Does not build from source in current unstable 2021-10-01
#995329 src:golang-github-likexian-gokit golang-github-likexian-gokit: FTBFS 2021-09-29
#995333 src:polyml polyml: FTBFS on arm64: Segmentation fault ./polyimport polytemp.txt -I . < ./exportPoly.sml 2021-09-29
#995339 lalrpop lalrpop: Incomplete license information 2021-09-29
#995353 src:ruby-protocol-http ruby-protocol-http: autopkgtest regression on armhf and i386 (both 32 bits) 2021-10-17
#995354 src:ruby-async-http ruby-async-http: autopkgtest needs update for new version of ruby-protocol-http: Could not find 'protocol-http' (~> 0.20.0) 2021-09-30
#995355 src:node-public-encrypt node-public-encrypt: autopkgtest regression: deprecation warning on stderr 2021-09-30
#995356 src:python-parameterized python-parameterized: autopkgtest regression: AssertionError in tearDownModule 2021-09-30
#995358 src:ruby-graphql, src:ruby-batch-loader ruby-graphql breaks ruby-batch-loader autopkgtest: uninitialized constant GraphQL::StaticValidation::Validator::Timeout 2021-09-30
#995359 src:ruby-gitlab-labkit ruby-gitlab-labkit: autopkgtest needs update for new version of ruby-jaeger-client: Could not find 'jaeger-client' (~> 0.10) 2021-09-30
#995360 src:pytorch pytorch: autopkgtest regression: fft: ATen not compiled with MKL support 2021-09-30
#995365 python3-sphinxcontrib.plantuml Cannot import module: ImportError: cannot import name 'ENOENT' from 'sphinx.util.osutil' 2021-10-16
#995387 dpkg dpkg: remove-on-upgrade deletes symlink targets owned by another package 2021-10-02
#995402 src:libclass-dbi-sweet-perl libclass-dbi-sweet-perl: FTBFS: test failure 2021-10-01
#995410 src:breezy breezy: FTBFS: 2021-10-04
#995411 src:ruby-omniauth-ultraauth ruby-omniauth-ultraauth: autopkgtest needs update for new version of ruby-omniauth-openid-connect: Could not find 'omniauth_openid_connect' (~> 0.3.0) 2021-09-30
#995412 src:libstring-copyright-perl, src:licensecheck libstring-copyright-perl breaks licensecheck autopkgtest: lots of different outputs 2021-09-30
#995419 src:rust-utf-8 rust-utf-8: autopkgtest regression: crate directory not found: /usr/share/cargo/registry/utf-8-0.7.6 2021-10-18
#995421 src:rust-bumpalo rust-bumpalo: autopkgtest armhf regression: oom_instead_of_bump_pointer_overflow 2021-09-30
#995424 libgmsh4 libgmsh4: SONAME bump without package rename 2021-09-30
#995445 logidee-tools logidee-tools: creates incorrect TeX code, breaks other packages via autopkgtests 2021-10-18
#995452 libpam-ssh libpam-ssh breaks the agent-forwarding of normal ssh 2021-10-03
#995465 src:django-restricted-resource django-restricted-resource: autopkgtest fails for python-django >= 3 2021-10-17
#995475 bash-static bash-static: segfault on startup when running with glibc 2.32 2021-10-01
#995477 cppman cppman: error: no such table: cppreference.com_keywords 2021-10-01
#995480 src:ytree FTBFS: error: format not a string literal and no format arguments 2021-10-16
#995492 lintian lintian: Broken --fails-on=none as default never got reverted 2021-10-02
#995571 src:boost1.74 boost1.74: autopkgtest failure on !amd64 architectures 2021-10-02
#995578 libxmlada libxmlada build-depends onunicode-data (< 14~) but testing/unstable has 14.0.0-1 2021-10-02
#995579 utf8proc utf8proc build-depends onunicode-data (< 13.1) but testing/unstable has 14.0.0-1 2021-10-02
#995580 wine wine build-depends on unicode-data (< 14) but testing/unstable has 14.0.0-1 2021-10-10
#995595 src:guile-3.0 FTBFS: 50813 Profiling timer expired ${dir}$tst 2021-10-02
#995600 src:omega-rpg FTBFS: error: format not a string literal and no format arguments 2021-10-12
#995603 src:why3 FTBFS: pdflatex fails with no message 2021-10-12
#995623 src:refind refind FTBFS: error: conflicting types for ‘EFI_DEVICE_PATH_UTILITIES_PROTOCOL’ 2021-10-21
#995624 src:pktstat pktstat FTBFS: error: format not a string literal and no format arguments [-Werror=format-security] 2021-10-14
#995625 src:httping httping FTBFS: error: format not a string literal and no format arguments [-Werror=format-security] 2021-10-12
#995653 src:django-mailman3, src:hyperkitty django-mailman3 breaks hyperkitty autopkgtest: 'str' object has no attribute 'display_name' 2021-10-03
#995655 dnsmasq dnsmasq breaks systemd autopkgtest: b'megasearch.net: 192.168.42.1' not found in b'megasearch.net: 207.148.248.143 2021-10-03
#995709 korganizer korganizer: Korganizer fails to start due to Akonadi not working 2021-10-05
#995735 src:dask.distributed dask.distributed: autopkgtest sometimes times out on ci.d.n worker since dask migrated 2021-10-19
#995740 src:tdigest tdigest FTBFS on several architectures: tdigest_percentile test failure 2021-10-04
#995742 src:ddnet ddnet armhf autopkgtest regression due to compiler warning 2021-10-04
#995769 dbab dbab: v1.5.7 package fail to upgrade from bullseye (1.5.01-1) 2021-10-08
#995779 mailman3 autopkgtest fails with sqlalchemy 1.4.23+ds1 2021-10-12
#995781 src:python-sqlsoup python-sqlsoup autopkgtest fails with SQLAlchemy 1.4.23+ds1-2 2021-10-12
#995783 src:python-marshmallow-sqlalchemy python-marshmallow-sqlalchemy autopkgtest fails with SQLAlchemy 1.4.23+ds1-2 2021-10-12
#995786 src:mesa mesa: FTBFS on i386 with llvm 13: ‘class llvm::TargetOptions’ has no member named ‘StackAlignmentOverride’ 2021-10-05
#995799 nvidia-legacy-340xx-driver nvidia-legacy-340xx-driver startx failure on 5.14.9 2021-10-05
#995830 openlp openlp: License incompatible with PyQt5 2021-10-06
#995832 libhealpix-cxx3 libhealpix-cxx3: missing Breaks+Replaces: libhealpix-cxx2 (>= 3.80) 2021-10-22
#995837 bareos Should bareos be removed? 2021-10-06
#995838 src:condor Should condor be removed? 2021-10-06
#995843 src:abook abook: missing licenses in d/copyright 2021-10-13
#995846 pgloader FTBFS: Fatal TYPE-ERROR and tests incompatible with PG14 2021-10-12
#995847 paulstretch paulstretch: Program crashes on Play or Render Selection - for debian Bullseye and Bookworm 2021-10-06
#995863 libmediainfo-dev libmediainfo-dev: Missing tfsxml_* symbols 2021-10-09
#995879 ansible uninstallable due to dependency on ansible-core 2021-10-07
#995888 src:nvidia-cuda-toolkit nvidia-cuda-toolkit/experimental rejected after upload 2021-10-07
#995908 src:php-async-aws-core php-async-aws-core: unsatisfiable build-dependency 2021-10-08
#995910 src:gitaly gitaly: unsatisfiable build-dependency 2021-10-08
#995928 src:acorn acorn: doc directory shipped by both binaries 2021-10-12
#995933 smart-notifier smart-notifier: crashes: AttributeError: 'gi.repository.Gtk' object has no attribute 'main' 2021-10-08
#995966 epigrass epigrass: epirunner and epidash fail to run due to missing dash modules 2021-10-09
#995968 gkrellm-leds gkrellm-leds: This gkrellm plugin does not start, Error: undefined symbol: XTestFakeKeyEvent 2021-10-18
#995979 src:pamix pamix FTBFS: error: format not a string literal and no format arguments [-Werror=format-security] 2021-10-12
#995999 prometheus FTBFS: FAIL: TestChunkDiskMapper_WriteChunk_Chunk_IterateChunks 2021-10-14
#996028 mariadb-server InnoDB: corrupted TRX_NO after upgrading to 10.3.31 2021-10-22
#996039 xorg xorg: Insignia Tablet, NS-P10W8100, touchpad upside down/inverted, using Mate/lighdm. 2021-10-10
#996042 ttyd Missing sources for the html part 2021-10-10
#996048 src:postfix-mta-sts-resolver postfix-mta-sts-resolver: autopkgtest doesn't handle new version of ca-certificates nicely: rehash: warning: skipping ca-certificates.crt,it does not contain exactly one certificate or CRL 2021-10-19
#996051 gnome-shell-extension-desktop-icons gnome-shell-extension-desktop-icons: does not declare compatibility with GNOME Shell 41 2021-10-17
#996052 gnome-shell-extension-disconnect-wifi gnome-shell-extension-disconnect-wifi: does not declare compatibility with GNOME Shell 41 2021-10-17
#996054 gnome-shell-extension-draw-on-your-screen gnome-shell-extension-draw-on-your-screen: does not declare compatibility with GNOME Shell 41 2021-10-17
#996055 gnome-shell-extension-easyscreencast gnome-shell-extension-easyscreencast: does not declare compatibility with GNOME Shell 41 2021-10-17
#996057 gnome-shell-extension-gamemode gnome-shell-extension-gamemode: does not declare compatibility with GNOME Shell 41 2021-10-17
#996061 gnome-shell-extension-hide-activities gnome-shell-extension-hide-activities: does not declare compatibility with GNOME Shell 41 2021-10-17
#996062 gnome-shell-extension-hide-veth gnome-shell-extension-hide-veth: does not declare compatibility with GNOME Shell 41 2021-10-17
#996063 gnome-shell-extension-hijra gnome-shell-extension-hijra: does not declare compatibility with GNOME Shell 41 2021-10-17
#996065 gnome-shell-extension-move-clock gnome-shell-extension-move-clock: does not declare compatibility with GNOME Shell 41 2021-10-17
#996066 gnome-shell-extension-multi-monitors gnome-shell-extension-multi-monitors: does not declare compatibility with GNOME Shell 41 2021-10-17
#996067 gnome-shell-extension-no-annoyance gnome-shell-extension-no-annoyance: does not declare compatibility with GNOME Shell 41 2021-10-17
#996068 gnome-shell-extension-panel-osd gnome-shell-extension-panel-osd: does not declare compatibility with GNOME Shell 41 2021-10-17
#996069 gnome-shell-extension-pixelsaver gnome-shell-extension-pixelsaver: does not declare compatibility with GNOME Shell 41 2021-10-17
#996072 gnome-shell-extension-tilix-dropdown gnome-shell-extension-tilix-dropdown: does not declare compatibility with GNOME Shell 41 2021-10-17
#996074 gnome-shell-extension-trash gnome-shell-extension-trash: does not declare compatibility with GNOME Shell 41 2021-10-22
#996077 gnome-shell-mailnag gnome-shell-mailnag: does not declare compatibility with GNOME Shell 41 2021-10-17
#996098 src:libxsmm libxsmm: CVE-2021-39535 CVE-2021-39536 2021-10-11
#996108 php-doctrine-bundle Useless in Debian 2021-10-11
#996113 src:libmodulemd libmodulemd: Please move Modulemd.py GObject introspection override to gir1.2-modulemd-2.0 2021-10-11
#996114 src:atig atig: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: NoMethodError: 2021-10-11
#996116 src:r10k r10k: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: 2021-10-11
#996117 src:ruby-active-model-serializers ruby-active-model-serializers: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: wrong number of arguments (given 2, expected 3) 2021-10-11
#996118 src:pry pry: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: NoMethodError: 2021-10-11
#996119 src:ruby-activerecord-nulldb-adapter ruby-activerecord-nulldb-adapter: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: Failure/Error: Employee.create 2021-10-11
#996120 src:ruby-acts-as-list ruby-acts-as-list: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: wrong number of arguments (given 3, expected 2) 2021-10-11
#996121 src:ruby-acts-as-tree ruby-acts-as-tree: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: /usr/share/rubygems-integration/all/gems/activerecord-6.0.3.7/lib/active_record/associations/builder/association.rb:51:in `build_scope': undefined method `arity' for {:class_name=>"LevelMixin", :primary_key=>"id", :foreign_key=>"parent_id", :counter_cache=>nil, :touch=>false, :inverse_of=>:children, :optional=>true}:Hash (NoMethodError) 2021-10-11
#996122 src:ruby-addressable ruby-addressable: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: 2021-10-11
#996123 src:ruby-api-pagination ruby-api-pagination: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: 2021-10-11
#996124 src:ruby-appraiser ruby-appraiser: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: No such file or directory @ rb_sysopen - http://rubygems.org/api/v1/gems/rails.json 2021-10-11
#996125 src:ruby-arbre ruby-arbre: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: RuntimeError: 2021-10-11
#996126 src:ruby-attr-encrypted ruby-attr-encrypted: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: wrong number of arguments (given 2, expected 1) 2021-10-11
#996127 src:ruby-avl-tree ruby-avl-tree: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: Error: test_each_value(TestRedBlackTree): ArgumentError: tried to create Proc object without a block 2021-10-11
#996128 src:ruby-awesome-print ruby-awesome-print: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: 2021-10-11
#996129 src:ruby-axiom-types ruby-axiom-types: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: RuntimeError: 2021-10-11
#996130 src:clickhouse clickhouse FTBFS with gcc 11 2021-10-11
#996132 src:ruby-backports ruby-backports: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: /usr/lib/ruby/gems/3.0.0/gems/rake-13.0.3/lib/rake/testtask.rb:130:in `block (3 levels) in define': Command failed with status (1) (RuntimeError) 2021-10-11
#996133 src:ruby-barby ruby-barby: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: <internal:/usr/lib/ruby/vendor_ruby/rubygems/core_ext/kernel_require.rb>:85:in `require': cannot load such file -- sorted_set (LoadError) 2021-10-11
#996135 src:ruby-benchmark-memory ruby-benchmark-memory: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: 2021-10-11
#996136 src:ruby-bindex ruby-bindex: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed. 2021-10-11
#996137 src:ruby-binding-of-caller ruby-binding-of-caller: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: <internal:/usr/lib/ruby/vendor_ruby/rubygems/core_ext/kernel_require.rb>:85:in `require': cannot load such file -- binding_of_caller.so (LoadError) 2021-10-11
#996138 src:ruby-bio ruby-bio: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: Error: test_target(Bio::TestSiRNAPair): NoMethodError: undefined method `subseq' for "cuuucggugcggacguaaggagu":String 2021-10-11
#996139 src:ruby-bluefeather ruby-bluefeather: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: NoMethodError: 2021-10-11
#996140 src:ruby-bogus ruby-bogus: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: # ArgumentError: 2021-10-11
#996141 src:ruby-bootsnap ruby-bootsnap: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed. 2021-10-11
#996142 src:ruby-buff-config ruby-buff-config: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: RuntimeError: 2021-10-11
#996143 src:ruby-bunny ruby-bunny: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: RuntimeError: 2021-10-11
#996145 src:ruby-byebug ruby-byebug: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: "/usr/lib/ruby/vendor_ruby/rubygems/core_ext/kernel_require.rb:85:in `require': cannot load such file -- byebug/byebug (LoadError)\n" + 2021-10-11
#996147 src:ruby-capybara ruby-capybara: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: 2021-10-11
#996152 src:libsemanage libsemanage: FTBFS: build-dependency not installable: secilc (>= 3.2) 2021-10-11
#996154 src:obexftp obexftp: FTBFS with ruby3.0: ld: final link failed: bad value 2021-10-11
#996155 src:origami-pdf origami-pdf: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: wrong number of arguments (given 2, expected 1) 2021-10-11
#996156 src:ruby-ahoy-email ruby-ahoy-email: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed. 2021-10-11
#996157 src:ruby-clean-test ruby-clean-test: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: Error: test_any_symbol_works(TestAny): ArgumentError: wrong number of arguments (given 2, expected 0..1) 2021-10-11
#996159 src:ruby-batch-loader ruby-batch-loader: FTBFS: ERROR: Test "ruby2.7" failed: Failure/Error: result = schema.execute(query) 2021-10-11
#996170 src:linux linux: FTBFS if bpftool detects clang-bpf-co-re 2021-10-12
#996171 src:glibmm2.4 glibmm2.4: FTBFS on buildds / reproducible builds without network access 2021-10-11
#996206 src:ruby-cocaine ruby-cocaine: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: Failure/Error: undef_method :exitstatus 2021-10-12
#996207 src:ruby-combustion ruby-combustion: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: Failure/Error: require "bundler/setup" 2021-10-12
#996208 src:ruby-commander ruby-commander: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: RuntimeError: 2021-10-12
#996210 src:ruby-css-parser ruby-css-parser: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed. 2021-10-12
#996211 src:ruby-curb ruby-curb: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed. 2021-10-12
#996212 src:ruby-dalli ruby-dalli: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: wrong number of arguments (given 3, expected 2) 2021-10-12
#996215 src:ruby-dbf ruby-dbf: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: Failure/Error: @encoding ? value.force_encoding(@encoding).encode(*ENCODING_ARGS) : value 2021-10-12
#996216 src:ruby-devise-two-factor ruby-devise-two-factor: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: 2021-10-12
#996217 src:ruby-dry-logic ruby-dry-logic: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: 2021-10-12
#996220 src:ruby-escape-utils ruby-escape-utils: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: NoMethodError: undefined method `escape' for URI:Module 2021-10-12
#996221 src:ruby-ethon ruby-ethon: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: Failure/Error: require 'rack/handler/webrick' 2021-10-12
#996222 src:ruby-factory-bot ruby-factory-bot: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: 2021-10-12
#996223 src:ruby-factory-girl ruby-factory-girl: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: 2021-10-12
#996224 src:ruby-faker ruby-faker: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: Error: test_ch_methods(TestZhLocale): ArgumentError: wrong number of arguments (given 2, expected 0..1) 2021-10-12
#996225 src:ruby-fakeredis ruby-fakeredis: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: 2021-10-12
#996226 src:ruby-fakeweb ruby-fakeweb: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: Error: test_mock_open_with_string_as_registered_uri(TestFakeWebOpenURI): Errno::ENOENT: No such file or directory @ rb_sysopen - http://mock/test_string.txt 2021-10-12
#996227 src:ruby-ferret ruby-ferret: FTBFS with ruby3.0: index.h:595:25: error: width of ‘is_compressed’ exceeds its type 2021-10-12
#996228 src:ruby-ffaker ruby-ffaker: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: Error: test_ssn_with_from_to(TestSSNSE): ArgumentError: wrong number of arguments (given 4, expected 3) 2021-10-12
#996229 src:ruby-flexmock ruby-flexmock: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: wrong number of arguments (given 1, expected 0) 2021-10-12
#996230 src:ruby-friendly-id ruby-friendly-id: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: /usr/share/rubygems-integration/all/gems/activerecord-6.0.3.7/lib/active_record/associations.rb:1370:in `has_many': wrong number of arguments (given 3, expected 1..2) (ArgumentError) 2021-10-12
#996233 src:ruby-gd ruby-gd: FTBFS with ruby3.0: error: assignment of read-only member ‘klass’ 2021-10-12
#996234 src:ruby-github-markup ruby-github-markup: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed. 2021-10-12
#996235 src:ruby-gitlab-fog-azure-rm ruby-gitlab-fog-azure-rm: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: tried to create Proc object without a block 2021-10-12
#996236 src:ruby-gitlab ruby-gitlab: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: Failure/Error: expect(@help_output).to eq("Gitlab.create_branch(4, 'new-branch', 'master')") 2021-10-12
#996237 src:ruby-gsl ruby-gsl: FTBFS with ruby3.0: include/rb_gsl_common.h:29:1: error: unknown type name ‘EXTERN’ 2021-10-12
#996238 src:ruby-hamster ruby-hamster: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: RuntimeError: 2021-10-12
#996239 src:ruby-hashie ruby-hashie: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: 2021-10-12
#996263 ctop ctop: Should this package be removed? 2021-10-12
#996277 src:deal.ii deal.ii: autopkgtest needs update for new version of gcc-defaults: An error occurred in line <1048> of file <./source/fe/mapping_q_generic.cc> in function 2021-10-12
#996279 src:xmds2 xmds2: autopkgtest needs update for new version of gcc-defaults: 5 tests fail to build 2021-10-12
#996280 src:seqan3 seqan3: autopkgtest needs update for new version of gcc-defaults 2021-10-12
#996291 src:ruby-hdfeos5 ruby-hdfeos5: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: <internal:/usr/lib/ruby/vendor_ruby/rubygems/core_ext/kernel_require.rb>:85:in `require': /<<PKGBUILDDIR>>/debian/ruby-hdfeos5/usr/lib/x86_64-linux-gnu/ruby/vendor_ruby/3.0.0/numru/hdfeos5raw.so: undefined symbol: rb_secure - /<<PKGBUILDDIR>>/debian/ruby-hdfeos5/usr/lib/x86_64-linux-gnu/ruby/vendor_ruby/3.0.0/numru/hdfeos5raw.so (LoadError) 2021-10-12
#996292 src:ruby-http ruby-http: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: cannot load such file -- webrick 2021-10-12
#996293 src:ruby-httparty ruby-httparty: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: 2021-10-12
#996294 src:ruby-httpclient ruby-httpclient: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed. 2021-10-12
#996295 src:ruby-i18n-inflector-rails ruby-i18n-inflector-rails: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: 2021-10-12
#996296 src:ruby-ice-cube ruby-ice-cube: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: 2021-10-12
#996297 src:ruby-ice-nine ruby-ice-nine: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: Failure/Error: expect(subject.end).to be_frozen 2021-10-12
#996298 src:ruby-influxdb ruby-influxdb: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: Failure/Error: specify { expect(conf.proxy_port).to eq(8080) } 2021-10-12
#996299 src:ruby-invisible-captcha ruby-invisible-captcha: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: Failure/Error: require 'bundler/setup' # Set up gems listed in the Gemfile. 2021-10-12
#996300 src:ruby-jaeger-client ruby-jaeger-client: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: 2021-10-12
#996301 src:ruby-jbuilder ruby-jbuilder: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed. 2021-10-12
#996302 src:ruby-joiner ruby-joiner: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: Failure/Error: require 'bundler/setup' 2021-10-12
#996303 src:ruby-json-jwt ruby-json-jwt: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: Failure/Error: 2021-10-12
#996304 src:ruby-json-schema ruby-json-schema: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: Errno::ENOENT: No such file or directory @ rb_sysopen - http://foo.bar/ 2021-10-12
#996305 src:ruby-json ruby-json: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: NoMethodError: undefined method `assert_separately' 2021-10-12
#996306 src:ruby-jsonpath ruby-jsonpath: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: RuntimeError: character '|' not supported in query. 2021-10-12
#996307 src:ruby-kitchen-docker ruby-kitchen-docker: FTBFS: ERROR: Test "ruby2.7" failed: /usr/lib/ruby/vendor_ruby/rubygems/specification.rb:1404:in `rescue in block in activate_dependencies': Could not find 'thor' (~> 0.19) among 82 total gem(s) (Gem::MissingSpecError) 2021-10-12
#996308 src:ruby-kitchen-salt ruby-kitchen-salt: FTBFS: ERROR: Test "ruby2.7" failed: /usr/lib/ruby/vendor_ruby/rubygems/specification.rb:1404:in `rescue in block in activate_dependencies': Could not find 'thor' (~> 0.19) among 70 total gem(s) (Gem::MissingSpecError) 2021-10-12
#996309 src:ruby-kubeclient ruby-kubeclient: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: /usr/lib/ruby/vendor_ruby/recursive_open_struct.rb:84:in `alias_method': undefined method `modifiable' for class `RecursiveOpenStruct' (NameError) 2021-10-12
#996310 src:ruby-kyotocabinet ruby-kyotocabinet: FTBFS with ruby3.0: stdalign.h:93:1: error: template with C linkage 2021-10-12
#996311 src:ruby-lapack ruby-lapack: FTBFS: ERROR: Test "ruby2.7" failed. 2021-10-12
#996312 src:ruby-librarian ruby-librarian: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: tried to create Proc object without a block 2021-10-12
#996313 src:ruby-libvirt ruby-libvirt: FTBFS with ruby3.0: common.c:27:10: fatal error: st.h: No such file or directory 2021-10-12
#996314 src:ruby-liquid ruby-liquid: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: wrong number of arguments (given 1, expected 0) 2021-10-12
#996315 src:ruby-listen ruby-listen: FTBFS: ERROR: Test "ruby2.7" failed: Failure/Error: 2021-10-12
#996316 src:ruby-mechanize ruby-mechanize: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: /usr/lib/ruby/vendor_ruby/rubygems/dependency.rb:311:in `to_specs': Could not find 'webrick' (~> 1.6) among 107 total gem(s) (Gem::MissingSpecError) 2021-10-12
#996317 src:ruby-memory-profiler ruby-memory-profiler: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed. 2021-10-12
#996318 src:ruby-messagebus-api ruby-messagebus-api: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: expected no Exception, got #<NoMethodError: undefined method `escape' for URI:Module> with backtrace: 2021-10-12
#996319 src:ruby-mini-magick ruby-mini-magick: FTBFS: ERROR: Test "ruby2.7" failed: Failure/Error: expect(described_class.new(output_path.to_s)).to be_valid 2021-10-12
#996320 src:ruby-minitest-excludes ruby-minitest-excludes: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed. 2021-10-12
#996321 src:ruby-mixlib-install ruby-mixlib-install: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: cannot load such file -- webrick 2021-10-12
#996322 src:ruby-mmap2 ruby-mmap2: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: <internal:/usr/lib/ruby/vendor_ruby/rubygems/core_ext/kernel_require.rb>:85:in `require': cannot load such file -- mmap (LoadError) 2021-10-12
#996323 src:ruby-mono-logger ruby-mono-logger: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: wrong number of arguments (given 2, expected 0..1) 2021-10-12
#996324 src:ruby-netcdf ruby-netcdf: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: Segmentation fault at 0x0000000000000034 2021-10-12
#996334 src:libics libics: binary-all FTBFS 2021-10-13
#996336 src:pygalmesh pygalmesh: autopkgtest regression on i386 2021-10-14
#996341 src:ruby-ntlm ruby-ntlm: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: Failure/Error: dec.encrypt.update(plain) + dec.final 2021-10-13
#996342 src:ruby-omniauth-openid-connect ruby-omniauth-openid-connect: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: wrong number of arguments (given 2, expected 0..1) 2021-10-13
#996343 src:ruby-openid ruby-openid: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: <internal:/usr/lib/ruby/vendor_ruby/rubygems/core_ext/kernel_require.rb>:85:in `require': cannot load such file -- webrick (LoadError) 2021-10-13
#996344 src:ruby-openstack ruby-openstack: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: Error: test_rebuild_server(ServersTest): NoMethodError: undefined method `encode' for URI:Module 2021-10-13
#996345 src:ruby-packable ruby-packable: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: tried to create Proc object without a block 2021-10-13
#996346 src:ruby-parallel ruby-parallel: FTBFS with ruby3.0: ERROR: Test "ruby2.7" failed: Failure/Error: out.should == "0,1\nOK" 2021-10-13
#996347 src:ruby-prawn ruby-prawn: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: 2021-10-13
#996348 src:ruby-process-daemon ruby-process-daemon: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: cannot load such file -- webrick 2021-10-13
#996349 src:ruby-public-suffix ruby-public-suffix: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: wrong number of arguments (given 2, expected 1) 2021-10-13
#996350 src:ruby-rabl ruby-rabl: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed. 2021-10-13
#996351 src:ruby-rack-oauth2 ruby-rack-oauth2: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: NoMethodError: 2021-10-13
#996352 src:ruby-rack-timeout ruby-rack-timeout: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: Error: test_zero_wait_timeout(EnvSettingsTest): ArgumentError: wrong number of arguments (given 2, expected 1) 2021-10-13
#996353 src:ruby-rack ruby-rack: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed. 2021-10-13
#996361 iitalian iitalian: Italian hash file not compatible with current version of ispell 2021-10-13
#996363 src:ruby-rbpdf ruby-rbpdf: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: Error: test: Image get image file test(RbpdfHttpTest): NoMethodError: undefined method `shutdown' for nil:NilClass 2021-10-13
#996364 src:ruby-recursive-open-struct ruby-recursive-open-struct: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: Failure/Error: alias_method :modifiable?, :modifiable 2021-10-13
#996365 src:ruby-redis-activesupport ruby-redis-activesupport: FTBFS: ERROR: Test "ruby2.7" failed: several test failures 2021-10-13
#996366 src:ruby-regexp-parser ruby-regexp-parser: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: Failure/Error: (min..max).tap { |r| r.define_singleton_method(:minmax) { [min, max] } } 2021-10-13
#996369 src:ruby-responders ruby-responders: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed. 2021-10-13
#996370 src:ruby-rgen ruby-rgen: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed. 2021-10-13
#996371 src:ruby-roo ruby-roo: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: NoMethodError: 2021-10-13
#996372 src:ruby-roxml ruby-roxml: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: NoMethodError: 2021-10-13
#996375 chromium chromium build-depends on removed package. 2021-10-13
#996377 src:ruby-rspec-rails ruby-rspec-rails: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: 2021-10-13
#996378 src:ruby-rspec-retry ruby-rspec-retry: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: Failure/Error: 2021-10-13
#996379 src:ruby-rspec ruby-rspec: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: Failure/Error: DEFAULT_FAILURE_NOTIFIER = lambda { |failure, _opts| raise failure } 2021-10-13
#996380 src:ruby-safe-yaml ruby-safe-yaml: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: 2021-10-13
#996381 src:ruby-sanitize ruby-sanitize: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: wrong number of arguments (given 4, expected 1..3) 2021-10-13
#996382 src:ruby-seamless-database-pool ruby-seamless-database-pool: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: 2021-10-13
#996383 src:ruby-semantic-puppet ruby-semantic-puppet: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: RuntimeError: 2021-10-13
#996384 src:ruby-serialport ruby-serialport: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: <internal:/usr/lib/ruby/vendor_ruby/rubygems/core_ext/kernel_require.rb>:85:in `require': /<<PKGBUILDDIR>>/debian/ruby-serialport/usr/lib/x86_64-linux-gnu/ruby/vendor_ruby/3.0.0/serialport.so: undefined symbol: rb_secure - /<<PKGBUILDDIR>>/debian/ruby-serialport/usr/lib/x86_64-linux-gnu/ruby/vendor_ruby/3.0.0/serialport.so (LoadError) 2021-10-13
#996385 src:ruby-shadow ruby-shadow: FTBFS with ruby3.0: ld: cannot find -lshadow 2021-10-13
#996386 src:ruby-sham-rack ruby-sham-rack: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: cannot load such file -- webrick/httputils 2021-10-13
#996387 src:ruby-sigar ruby-sigar: FTBFS with ruby3.0: sigar_util.c:742:10: fatal error: rpc/rpc.h: No such file or directory 2021-10-13
#996403 src:ruby-rails-controller-testing ruby-rails-controller-testing: FTBFS: ERROR: Test "ruby3.0" failed. 2021-10-13
#996404 src:ruby-sassc-rails ruby-sassc-rails: FTBFS: ERROR: Test "ruby3.0" failed. 2021-10-13
#996406 src:python-pyramid, src:python-pyramid-chameleon python-pyramid breaks python-pyramid-chameleon autopkgtest: No module named 'pyramid.compat' 2021-10-13
#996407 src:diamond-aligner, src:proteinortho diamond-aligner breaks proteinortho autopkgtest: diamond failed with code 256 2021-10-16
#996409 src:libstatgen, src:minimac4 libstatgen breaks minimac4 autopkgtest: Segmentation fault 2021-10-13
#996414 src:python-fastimport python-fastimport: autopkgtest regression: 2 failures + lots of RuntimeError: maximum recursion depth exceeded 2021-10-13
#996437 src:elixir-lang elixir-lang: FTBFS with Erlang 24.1 (one test fails) 2021-10-21
#996448 src:llvm-toolchain-13 llvm-toolchain-13 autopkgtest segfaults on armhf 2021-10-14
#996483 src:mp3blaster mp3blaster FTBFS: error: format not a string literal and no format arguments [-Werror=format-security] 2021-10-17
#996486 libleveldb1d bitcoind: fails to start with undefined symbol: _ZTIN7leveldb6LoggerE 2021-10-17
#996487 nbd-client nbd-client: connects to localhost instead of the requested server 2021-10-18
#996500 src:wlroots wlroots FTBFS: error: ‘av_init_packet’ is deprecated [-Werror=deprecated-declarations] 2021-10-19
#996510 src:ruby-spring ruby-spring: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: Errno::ENOENT: No such file or directory @ rb_check_realpath_internal - /tmp/d20211005-1582813-mce9ae 2021-10-14
#996511 src:ruby-sprockets ruby-sprockets: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: wrong number of arguments (given 2, expected 1) 2021-10-20
#996512 src:ruby-spy ruby-spy: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: tried to create Proc object without a block 2021-10-14
#996513 src:ruby-stackprof ruby-stackprof: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed. 2021-10-14
#996514 src:ruby-terrapin ruby-terrapin: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: Failure/Error: undef_method :exitstatus 2021-10-14
#996515 src:ruby-tilt ruby-tilt: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: TypeError: no implicit conversion of Hash into String 2021-10-14
#996516 src:ruby-toml-rb ruby-toml-rb: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: Segmentation fault 2021-10-14
#996518 src:ruby-typhoeus ruby-typhoeus: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: Failure/Error: require 'rack/handler/webrick' 2021-10-14
#996519 src:ruby-vagrant-cloud ruby-vagrant-cloud: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: 2021-10-14
#996520 src:ruby-varia-model ruby-varia-model: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: Failure/Error: expect(subject.to_json).to eql(JSON.dump(first_name: "brooke", nick: "leblanc")) 2021-10-14
#996521 src:ruby-vcr ruby-vcr: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: cannot load such file -- webrick 2021-10-14
#996522 src:ruby-vips ruby-vips: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: ArgumentError: 2021-10-14
#996523 src:ruby-websocket ruby-websocket: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: cannot load such file -- webrick 2021-10-14
#996524 src:ruby-whitequark-parser ruby-whitequark-parser: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed. 2021-10-14
#996525 src:ruby-xmlrpc ruby-xmlrpc: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed. 2021-10-14
#996526 src:rubygems rubygems: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed. 2021-10-14
#996527 src:sup-mail sup-mail: FTBFS: ERROR: Test "ruby2.7" failed: NameError: uninitialized constant ActiveSupport 2021-10-15
#996528 src:test-kitchen test-kitchen: FTBFS: ERROR: Test "ruby2.7" failed: Could not find 'thor' (~> 0.19) among 87 total gem(s) (Gem::MissingSpecError) 2021-10-15
#996529 src:vagrant vagrant: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: RuntimeError: 2021-10-22
#996530 src:yard yard: FTBFS with ruby3.0: ERROR: Test "ruby3.0" failed: cannot load such file -- webrick 2021-10-15
#996541 racon racon: FTBFS when rebuilt against libedlib1 2021-10-21
#996553 src:ptl ptl: autopkgtest failure on armhf 2021-10-21
#996557 src:linux linux-image-5.14.0-3-686-pae-unsigned: just about every sse2 program crashes with a SIGFPE 2021-10-15
#996559 src:minimap2 minimap2 FTBFS on !x86 2021-10-18
#996579 src:python-aioinflux FTBFS: test fail; doesn't abort after failure 2021-10-15
#996586 src:heimdal heimdal: CVE-2021-3671 2021-10-21
#996589 src:cloudcompare cloudcompare FTBFS on !amd64 2021-10-15
#996620 src:wp2latex FTBFS: error: cannot bind non-const lvalue reference of type ‘temp_string&’ to an rvalue of type ‘temp_string’ 2021-10-22
#996621 src:ruby-enumerable-statistics ruby-enumerable-statistics: FTBFS on i386: ERROR: Test "ruby2.7" failed: Failure/Error: it { is_expected.to eq(x) } 2021-10-16
#996625 frobtads RM: frobtads -- RoQA, unmainained, several RC bugs, low popcon 2021-10-16
#996632 src:llvm-toolchain-13 llvm-toolchain-13: autopkgtest failure on i386 2021-10-16
#996640 src:powertop powertop FTBFS: error: format not a string literal and no format arguments [-Werror=format-security] 2021-10-16
#996642 src:csh csh: FTBFS with glibc 2.32 2021-10-16
#996648 dkms dkms: The templates in /etc/dkms are pointing do debhelper 7 2021-10-16
#996712 src:libcache-memcached-fast-perl libcache-memcached-fast-perl: autopkgtest failure on armhf: Fetched all keys / Match results 2021-10-20
#996714 src:gnome-pass-search-provider gnome-pass-search-provider: fails to migrate to testing for too long 2021-10-20
#996747 src:debianutils src:debianutils: fails to migrate to testing for too long: blocked by sramacher 2021-10-18
#996756 src:golang-github-marten-seemann-qtls-go1-15 golang-github-marten-seemann-qtls-go1-15: FTBFS with golang/1.17: panic: qtls.ClientHelloInfo doesn't match 2021-10-19
#996757 src:golang-github-lucas-clemente-quic-go golang-github-lucas-clemente-quic-go: FTBFS with golang/1.17: panic: qtls.ClientHelloInfo doesn't match 2021-10-19
#996758 src:openlayer RM: openlayer: RoQA, unmaintained, dead upstream, low popcon 2021-10-19
#996761 kwin-x11 kwin-x11: KWin crashes and doesn't start 2021-10-18
#996780 gnome-boxes gnome-boxes: Systematic system freeze few seconds after launching a Windows WM 2021-10-18
#996781 luarocks luarocks: Installation fails with dpkg error 2021-10-21
#996795 elpa-ag silversearcher-ag-el: should drop dependencies on elpa-dash-functional 2021-10-19
#996798 src:llvm-toolchain-12 llvm-toolchain-12: FTBFS on mipsel|powerpc since 1:12.0.1-10: undefined reference to `_Unwind_Resume' etc. 2021-10-18
#996799 twitterwatch twitterwatch: unusable with tweepy version 4 2021-10-18
#996800 retweet retweet: unusable with tweepy version 4 2021-10-19
#996801 db2twitter db2twitter: unusable with tweepy version 4 2021-10-19
#996802 src:llvm-toolchain-12 llvm-toolchain-12: FTBFS on s390x since 1:12.0.1-10: Cannot find builtins library for the target architecture 2021-10-22
#996806 mailman3 mailmain3: Expected test results for arc_validate tests need updating 2021-10-19
#996807 tinydns tinydns stops replying to queries after a few hours 2021-10-19
#996829 src:llvm-toolchain-12 llvm-toolchain-12: 1:12.0.1-9 FTBFS on armel: llvm-ar.cpp.o: undefined reference to symbol '__atomic_fetch_sub_4@@LIBATOMIC_1.0' 2021-10-19
#996836 src:node-webpack node-webpack: webpack embeds binary files in es-module-lexer component 2021-10-19
#996843 rivet RM: rivet -- RoQA, unmaintained, python2, lowpopcon, RC-buggy 2021-10-19
#996845 src:hepmc RM: hepmc -- RoQA, unmaintained, RC-buggy, low-popcon 2021-10-19
#996846 src:pythia8 RM: pythia8 -- RoQA, unmaintained, low popcon 2021-10-19
#996847 sysrepo-plugind sysrepo-plugind fails to start 2021-10-19
#996848 src:bs1770gain bs1770gain FTBFS: error: this ‘if’ clause does not guard... [-Werror=misleading-indentation] 2021-10-19
#996849 dlz-ldap-enum RM: dlz-ldap-enum -- RoQA, unmaintained, dead-upstream, low popcon 2021-10-19
#996871 wmnet wmnet: crashes on launch 2021-10-20
#996878 python3-prelude python3-prelude: python3 import prelude throws an ImportError exception 2021-10-20
#996885 src:grpc grpc: FTBS: third_party/protobuf/src - No such file or directory 2021-10-20
#996887 libcmark0.30.1 libcmark0.30.1: 0.30.2 bumps SONAME without changing package name 2021-10-20
#996905 src:pms pms FTBFS: error: format not a string lite